floA

flottilin-like protein (in addition to FloT), resistence protein (against sublancin), accessory role in resistance to cefuroxime

Locus: BSU_25380

Isoelectric point: 4.92

Molecular weight: 35.48 kDa

Protein length: 331 aa

Gene length: 996 bp

Function: control of membrane fluidity

Product: flottilin-like protein

Essential: no

Synonyms: yqfA

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Membrane dynamics
• Lifestyles → Coping with stress → Resistance against toxins/ antibiotics
• Lifestyles → Coping with stress → Cell envelope stress proteins (controlled by SigM, V, W, X, Y)
• Groups of genes → Membrane proteins

Gene

Coordinates: 2,617,449 2,618,444

Phenotypes of a mutant

• reduced protein secretion PubMed
• a floT floA double mutant does not induce KinC-dependent biofilm formation upon addition of surfactin PubMed
• a floT floA double mutant has a strong synthetic defect in motility, cell morphology, and transformation efficiency PubMed
• a floT floA double mutant has a sporulation defect, due to the lack of FtsH PubMed
• a floA mutant produces increased amount of pulcherriminic acid PubMed
• a floA mutant has reduced sensitivity to vancomycin PubMed

The protein

Catalyzed reaction/ biological activity

• controls protease activity of FtsH PubMed

Protein family

• UPF0365 family (single member, according to UniProt)

Localization

• membrane PubMed
• co-localizes with FloT in discrete foci in the membrane PubMed
• forms focal structure in the cytoplasma membrane PubMed
• 13 foci FloA of are detected in strain 3610 PubMed

Expression and Regulation

Operons

• Genes: yqeZ-floA-yqfB
  Description: PubMed

  Sigma factors

  • SigW: sigma factor, PubMed, in SigW regulon

  Regulation

  • expressed under stress conditions (SigW) PubMed

Additional information

• the mRNA is cleaved by RNase III PubMed

Biological materials

Mutant

• MGNA-C443 (yqfA::erm), available at the NBRP B. subtilis, Japan
• JS119 (3610 markerless), available in Daniel Lopez's lab
• DL1401 (168 floA::mls), available in Daniel Lopez's lab
• BKE25380 (floA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATAACTTCTCCTCGTTT, downstream forward: _UP4_TAATCTCTCTAAGAAGGGAG
• BKK25380 (floA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATAACTTCTCCTCGTTT, downstream forward: _UP4_TAATCTCTCTAAGAAGGGAG

GFP fusion

• GK192 (3610 lacA::PfloT-yfp(mls)), available in Daniel Lopez's lab
• JS136 (3610 amyE::floT-gfp(spc)), available in Daniel Lopez's lab
• JS134 (3610 lacA::floA-mEos2 (mls)), available in Daniel Lopez's lab
• JS167 (3610 lacA::floA-PAmCherry (mls)), available in Daniel Lopez's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH) for FloA PubMed, available in Daniel Lopez's lab

References

Reviews

Loading

Original publications

Loading