sasA [2019-11-15 15:58:37]

(p)ppGpp synthetase, small alarmone synthetase

Locus: BSU_38480

Isoelectric point: 6.22

Molecular weight: 24.45 kDa

Protein length: 210 aa

Gene length: 633 bp

Function: ppGpp synthesis independent from stringent response

Product: (p)ppGpp synthetase

Essential: no

Synonyms: ywaC,relP,ipa-7d

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Nucleotide metabolism → Metabolism of signalling nucleotides
• Lifestyles → Coping with stress → Cell envelope stress proteins (controlled by SigM, V, W, X, Y)

Gene

Coordinates: 3,949,952 3,950,584

Phenotypes of a mutant

• a relA sasA sasB triple mutant requires branched chain amino acids, methionine and threonine for growth, the requirement can be suppressed by reduced expression of guaA or inactivation of codY PubMed
• a relA sasA sasB triple mutant acquires suppressor mutations in guaA, guaA, gmk or inactivation of codY PubMed

The protein

Catalyzed reaction/ biological activity

• ATP + GTP --> AMP + guanosine 3'-diphosphate 5'-triphosphate (according to UniProt)

Protein family

• RelA/SpoT family (with SasB and RelA, according to UniProt)

Paralogous protein(s)

• SasB

Domains

• single ppGpp synthetase domain PubMed

Structure

• 6FGK PubMed

Expression and Regulation

Operons

• Genes: sasA
  Description: PubMed

  Sigma factors

  • SigM: sigma factor, PubMed, in SigM regulon
  • SigW: sigma factor, in SigW regulon
  • SigV: sigma factor, in SigV regulon

  Regulatory mechanism

  • WalR: repression, PubMed, in WalR regulon

  Regulation

  • expression is reduced in a SigV mutant PubMed
  • exhibits high levels of extrinsic noise in expression (mediated via PrkC-dependent phosphorylation of WalR on Thr-101) PubMed

Biological materials

Mutant

• MGNA-B218 (ywaC::erm), available at the NBRP B. subtilis, Japan
• GP2066 (sasA sasB relA::mls), available in Jörg Stülke's lab
• BKE38480 (sasA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTTCGTCATCTCCTTTA, downstream forward: _UP4_TAAAAAAGACGGCACCCAAG
• BKK38480 (sasA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTTCGTCATCTCCTTTA, downstream forward: _UP4_TAAAAAAGACGGCACCCAAG

References

Reviews

Loading

Original publications

Loading