sdhA

succinate dehydrogenase (flavoprotein subunit)

Locus: BSU_28440

Isoelectric point: 5.71

Molecular weight: 65.17 kDa

Protein length: 586 aa

Gene length: 1761 bp

Function: TCA cycle

Product: succinate dehydrogenase (flavoprotein subunit)

Essential: no

Synonyms: citF

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Carbon metabolism → Carbon core metabolism → TCA cycle
• Groups of genes → Membrane proteins
• Groups of genes → Phosphoproteins → Phosphorylation on either a Ser, Thr or Tyr residue

Gene

Coordinates: 2,906,335 2,908,095

The protein

Catalyzed reaction/ biological activity

• quinone + succinate --> quinol + fumarate (according to UniProt)

Protein family

• FAD-dependent oxidoreductase 2 family (with NadB, according to UniProt)

Modification

• phosphorylated PubMed, PubMed

Cofactors

• Fe
• FAD (according to UniProt)

Effectors of protein activity

• Inhibited by 2-(n-Heptyl)-4-hydroxy-quinoline N-oxide PubMed
• Activated by Cytochrome b558 PubMed

Structure

• 1NEK (E. coli) PubMed

Localization

• attached to the membrane PubMed

Additional information

• This enzyme is a membrane-bound trimer PubMed PubMed
• One subunit is bound to cytochrome b558, and this subunit is the one bound to the cytosolic side of the membrane PubMed PubMed
• Another subunit is the flavoprotein one, required for FAD usage PubMed PubMed
• The other subunit has an iron-sulphur domain necessary for the catalytic activity PubMed PubMed
• extensive information on the structure and enzymatic properties of succinate dehydrogenase can be found at Proteopedia

Expression and Regulation

Operons

• Genes: sdhC-sdhA-sdhB
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulation

  • constitutive

Other regulations

• FsrA: translation inhibition, PubMed

Biological materials

Mutant

• GP743 ∆(sdhC-sdhA), cat, available in Jörg Stülke's lab
• GP792 ∆(sdhC-sdhA-sdhB)::phleo, available in Jörg Stülke's lab
• GP2342 ∆(sdhC-sdhA-sdhB)::kan, Cre-recombinase is integrated in sacA, available in Jörg Stülke's lab
• GP2343 ∆(sdhC-sdhA-sdhB)::lox72, Cre-recombinase is integrated in sacA, available in Jörg Stülke's lab
• BKE28440 ∆(sdhA)::erm trpC2 available at BGSC, PubMed, upstream reverse: _UP1_CATGATAGCCCCTCTCCCTC, downstream forward: _UP4_AAGAAGAAGGTGGCGAAATA
• BKK28440 ∆(sdhA::kan) trpC2 available at BGSC, PubMed, upstream reverse: _UP1_CATGATAGCCCCTCTCCCTC, downstream forward: _UP4_AAGAAGAAGGTGGCGAAATA

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

References

Reviews

Loading

Original publications

Loading