pchR

transcriptional repressor (MarR family), controls the expression of genes involved in pulcherriminic acid biosynthesis

Locus: BSU_35080

Isoelectric point: 8.09

Molecular weight: 19.54 kDa

Protein length: 169 aa

Gene length: 510 bp

Function: control of pulcherriminic acid biosynthesis

Product: transcription factor (MarR family)

Essential: no

Synonyms: yzhA,yvmB

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Homeostasis → Acquisition of iron → Acquisition of iron / Other

Gene

Coordinates: 3,604,993 3,605,502

Phenotypes of a mutant

• inactivation of pchR causes widespread disruption of proteins involved in cellular processes that depend on iron availability, with pleiotropic effects on proteins associated with carbon metabolism, translation, stress response, biosynthesis of cell wall, and sporulation initiation PubMed

The protein

Protein family

• MarR family of transcriptional regulators PubMed

Paralogous protein(s)

• YhjH

Domains

• HTH marR-type domain (aa 10-153) (according to UniProt)

Additional information

• Proposed consensus sequence for DNA-binding site: GTTYMMYMGTAAAC PubMed

Expression and Regulation

Operons

• Genes: pchR-yvmA
  Description: PubMed

  Regulatory mechanism

  • CcpA: repression, PubMed; PchR auto-repression PubMed, in CcpA regulon
  • PchR: repression, in PchR regulon

  Regulation

  • induced by iron starvation PubMed

Biological materials

Mutant

• CS217 (pchR::aphA3, available in Colin Harwood's and Jörg Stülke's lab PubMed
• BKE35080 (pchR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAGGCTACCTTCTTTCTT, downstream forward: _UP4_TAAACAAAAAGGCGGTGTAC
• BKK35080 (pchR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAGGCTACCTTCTTTCTT, downstream forward: _UP4_TAAACAAAAAGGCGGTGTAC

Labs working on this gene/protein

• Sandrine Auger, Micalis Institute, INRA, AgroParisTech, France

References

Loading