sipW

bifunctional signal peptidase I that controls surface-adhered biofilm formation and processes TasA and TapA

Locus: BSU_24630

Isoelectric point: 5.49

Molecular weight: 20.53 kDa

Protein length: 190 aa

Gene length: 573 bp

Function: biofilm formation

Product: signal peptidase I

Essential: no

Synonyms: yqhE

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Protein synthesis, modification and degradation → Protein secretion
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation → Amyloid protein synthesis, secretion and assembly
• Groups of genes → Membrane proteins

Gene

Coordinates: 2,553,930 2,554,502

The protein

Catalyzed reaction/ biological activity

• important for biofilm formation on a solid surface, but not required at an air-liquid interface PubMed
• Cleavage of hydrophobic, N-terminal signal or leader sequences from TasA and TapA PubMed

Protein family

• peptidase S26B family (single member, according to UniProt)

Localization

• membrane PubMed

Expression and Regulation

Operons

• Genes: tapA-sipW-tasA
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • AbrB: repression, PubMed, in AbrB regulon
  • SinR: repression, PubMed, in SinR regulon
  • RemA: activation, PubMed, in RemA regulon
  • LutR: activation, PubMed, in LutR regulon

  Regulation

  • repressed by casamino acids PubMed

  Additional information

  • induction by sequestration of SinR by SinI or SlrA PubMed or by SlrR PubMed
  • expression of the operon is localized to a ring near the periphery of the biofilm PubMed

Biological materials

Mutant

• MGNA-C439 (yqhE::erm), available at the NBRP B. subtilis, Japan
• 1A937 ( sipW::kan), PubMed, available at BGSC
• BKE24630 (sipW::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_AGTAAAGATGATCACGTATA, downstream forward: _UP4_TAACTTCAGTTGTAAACCTG
• BKK24630 (sipW::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_AGTAAAGATGATCACGTATA, downstream forward: _UP4_TAACTTCAGTTGTAAACCTG

Labs working on this gene/protein

• Beth Lazazzera, Los Angeles, USA

References

Reviews

Loading

Original publications

Loading