ywiE [2018-02-13T03:03:10.000Z]

minor cardiolipin synthetase, general stress protein, required for protection against paraquat stress

Locus: BSU37240

Isoelectric point: 8.38

Molecular weight: 58.08 kDa

Protein length: 500 aa

Gene length: 1500 bp

Function: phospholipiid biosynthesis, protection against paraquat stress

Product: minor cardiolipin synthetase

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Lipid metabolism → Biosynthesis of lipids → Biosynthesis of phospholipids
• Lifestyles → Coping with stress → General stress proteins (controlled by SigB)
• Lifestyles → Coping with stress → Resistance against oxidative and electrophile stress
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,821,570 → 3,823,072

The protein

Catalyzed reaction/ biological activity

• 2 Phosphatidylglycerol = diphosphatidylglycerol + glycerol (according to Swiss-Prot)

Protein family

• Cardiolipin synthase subfamily (according to Swiss-Prot)

Paralogous protein(s)

• ClsA, YwjE

Localization

• cell membrane (according to Swiss-Prot)

Expression and Regulation

Operons

• Genes: ywiE-ywjA-ywjB
  Description: PubMed

  Sigma factors

  • SigB: sigma factor, PubMed, in SigB regulon

  Regulatory mechanism

  • Fur: repression, PubMed, in Fur regulon

Biological materials

Mutant

• MGNA-A553 (ywiE::erm), available at the NBRP B. subtilis, Japan
• BKE37240 (ΔywiE::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCCTGATTCTCTCCAATC, downstream forward: _UP4_TAAGAAAAAAGAAATCTGAT
• BKK37240 (ΔywiE::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCCTGATTCTCTCCAATC, downstream forward: _UP4_TAAGAAAAAAGAAATCTGAT

References

Loading