oppD

oligopeptide ABC transporter (ATP-binding protein)

Locus: BSU_11460

Isoelectric point: 6.03

Molecular weight: 39.61 kDa

Protein length: 358 aa

Gene length: 1077 bp

Function: initiation of sporulation, competence development

Product: oligopeptide ABC transporter (ATP-binding protein)

Essential: no

Synonyms: spo0KD

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → ABC transporters → Importers → Uptake of peptides
• Metabolism → Amino acid/ nitrogen metabolism → Utilization of nitrogen sources other than amino acids → Utilization of peptides
• Information processing → Genetics → Genetic competence
• Information processing → Regulation of gene expression → phosphorelay
• Lifestyles → Exponential and early post-exponential lifestyles → Genetic competence
• Lifestyles → Sporulation → phosphorelay
• Groups of genes → Membrane proteins

Gene

Coordinates: 1,223,455 1,224,531

The protein

Catalyzed reaction/ biological activity

• required for the uptake of quorum sensing peptides such as PhrH PubMed

Protein family

• ABC transporter superfamily (according to UniProt)

Paralogous protein(s)

• AppD, DppD

Domains

• ABC transporter domain (aa 8-259) (according to UniProt)

Structure

• 4FWI (DppD from Caldanaerobacter subterraneus, 39% identity) PubMed

Localization

• attached to the cell membrane (via OppB-OppC) PubMed

Expression and Regulation

Operons

• Genes: oppA-oppB-oppC-oppD-oppF
  Description: PubMed

  Regulatory mechanism

  • TnrA: activation, PubMed, in TnrA regulon
  • CodY: repression, no derepression occurs, however, in a CodY mutant, due to increased repression by ScoC PubMed, in CodY regulon
  • ScoC: repression, PubMed, in ScoC regulon

  Regulation

  • expressed in the absence of good nitrogen sources (glutamine or ammonium) (TnrA) PubMed

  Additional information

  • A ncRNA is predicted between 'trpS' and 'oppA' PubMed

Biological materials

Mutant

• GP2097 (D(oppA-oppB-oppC-oppD-oppF)::aphA3), available in Jörg Stülke's lab
• BKE11460 (oppD::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TAGGCGTGTCACCCGTATCA, downstream forward: _UP4_GTCTTAGTGAGAGAAGTTGA
• BKK11460 (oppD::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TAGGCGTGTCACCCGTATCA, downstream forward: _UP4_GTCTTAGTGAGAGAAGTTGA

References

Loading