mrnC

RNase Mini-III

Locus: BSU_00950

Isoelectric point: 9.15

Molecular weight: 16.09 kDa

Protein length: 143 aa

Gene length: 432 bp

Function: maturation of 23S rRNA

Product: RNase Mini-III

Essential: no

Synonyms: yazC

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → RNA synthesis and degradation → RNases → Endoribonucleases
• Information processing → Protein synthesis, modification and degradation → Translation → rRNA modification and maturation

Gene

Coordinates: 114,854 115,285

The protein

Protein family

• MrnC RNase family (single member, according to UniProt)

Effectors of protein activity

• RplC binding to the precursor 23S rRNA stimulates MrnC activity PubMed

Structure

• 4OUN PubMed

Expression and Regulation

Operons

• Genes: gltX-cysE-cysS-mrnC-yacO-yacP
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • T-box: transcription antitermination, overlaps a transcription terminator upstream of cysE, in T-box

  Regulation

  • expression transiently increases in the forespore PubMed
  • the T-box RNA is degraded by RNase Y PubMed

Biological materials

Mutant

• MGNA-B883 (yazC::erm), available at the NBRP B. subtilis, Japan
• BKE00950 (mrnC::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TATCGTATCAAATTCAAGCA, downstream forward: _UP4_TTCGGGACGTCAGGGAGGAA
• BKK00950 (mrnC::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TATCGTATCAAATTCAAGCA, downstream forward: _UP4_TTCGGGACGTCAGGGAGGAA

Labs working on this gene/protein

• Ciaran Condon, IBPC, Paris, France Homepage
• David Bechhofer, Mount Sinai School, New York, USA Laboratories and Programs/Bechhofer Laboratory?citype=Physician&ciid=Bechhofer David H 1255565 Homepage

References

Loading