component of the SpoIIIA-SpoIIQ type III secretion system residing in the forespore membrane, required for SigG activation
function
activation of SigG, forespore encasement by the spore coat
product
part of the transmembrane channel linking the mother cell and the forespore
Genomic Context
categories
[category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion][category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other][category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]Gene
Coordinates
2,532,353 → 2,533,009
Phenotype of a mutant
reduced sporulation efficiency (1 to 10% compared to wild type) [Pubmed|26735940]the ''[gene|8F3751A3D0910C9BED7FBCE90AFF7FDACFDCBC0B|spoIIIL] [gene|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|spoIIIAH]'' double mutant has a severe sporulation defect (0.001%) [Pubmed|26735940]block of sporulation after engulfmentThe protein
Catalyzed reaction/ biological activity
required for forespore encasement by the spore coat [Pubmed|22171814]Structure
[PDB|3UZO]; [PDB|3TUF] (the [protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ]-[protein|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|SpoIIIAH] pore forming complex) [Pubmed|22431604,22431613][SW|Localization]
membrane protein, forms a transmembrane channel linking the mother cell and the forespore (with [protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ]) [Pubmed|22431604,22431613,22171814,18485064]proper recruitment to the sporulation septum on the mother cell side requires [protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ] [Pubmed|23834622]Expression and Regulation
Operons
genes
[gene|70408C17CF8681998F7FD933D4BFF71D052626D9|yqhV]-[gene|5FE74F270B28A404BFE0DAA4EB243009EEDEACF0|spoIIIAA]-[gene|D20198968665D3726839B2DC7F0638614319B853|spoIIIAB]-[gene|5CDBE6E299C7E6606D3C52E509CFED6F41F1E3F8|spoIIIAC]-[gene|576E36DA79F1ED097D649C35C5B59622FF1CFEF3|spoIIIAD]-[gene|9D4AE9AE191BFA82791549852782DC1B959A6897|spoIIIAE]-[gene|8A8C67AB955660FA41039B45F60A5B9F7B57704E|spoIIIAF]-[gene|5456B0C27EAE89F5B9E750D65E1E3C6EDA27C9FA|spoIIIAG]-[gene|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|spoIIIAH]
description
[Pubmed|1766372]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,18485064], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]regulatory mechanism
[protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]regulation
both promoters: expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|18485064], switched off by [SW|SpoIIID] [Pubmed|15383836]additional information
the internal promoter is essential for sporulation, it is twice as active as the promoter in front of [protein|search|spoIIIAA], suggesting that [protein|search|SpoIIIAG] and [protein|search|SpoIIIAH] are required in larger amounts as compared to the other products of the operon [http://www.ncbi.nlm.nih.gov/sites/entrez/17693505 PubMed]view in new tabgenes
[gene|5456B0C27EAE89F5B9E750D65E1E3C6EDA27C9FA|spoIIIAG]-[gene|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|spoIIIAH]
description
[Pubmed|17693505]
regulation
both promoters: expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|18485064], switched off by [SW|SpoIIID] [Pubmed|15383836]additional information
the internal promoter is essential for sporulation, it is twice as active as the promoter in front of [protein|search|spoIIIAA], suggesting that [protein|search|SpoIIIAG] and [protein|search|SpoIIIAH] are required in larger amounts as compared to the other products of the operon [http://www.ncbi.nlm.nih.gov/sites/entrez/17693505 PubMed]view in new tabgenes
[gene|5FE74F270B28A404BFE0DAA4EB243009EEDEACF0|spoIIIAA]-[gene|D20198968665D3726839B2DC7F0638614319B853|spoIIIAB]-[gene|5CDBE6E299C7E6606D3C52E509CFED6F41F1E3F8|spoIIIAC]-[gene|576E36DA79F1ED097D649C35C5B59622FF1CFEF3|spoIIIAD]-[gene|9D4AE9AE191BFA82791549852782DC1B959A6897|spoIIIAE]-[gene|8A8C67AB955660FA41039B45F60A5B9F7B57704E|spoIIIAF]-[gene|5456B0C27EAE89F5B9E750D65E1E3C6EDA27C9FA|spoIIIAG]-[gene|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|spoIIIAH]
description
[Pubmed|18485064]
regulation
both promoters: expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|18485064], switched off by [SW|SpoIIID] [Pubmed|15383836]additional information
the internal promoter is essential for sporulation, it is twice as active as the promoter in front of [protein|search|spoIIIAA], suggesting that [protein|search|SpoIIIAG] and [protein|search|SpoIIIAH] are required in larger amounts as compared to the other products of the operon [http://www.ncbi.nlm.nih.gov/sites/entrez/17693505 PubMed]view in new tabBiological materials
Mutant
BKE24360 (Δ[gene|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|spoIIIAH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCAAACGGTTTGTTTTTTAA, downstream forward: _UP4_TAAGAATGAGGGAAAAAAGCBKK24360 (Δ[gene|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|spoIIIAH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCAAACGGTTTGTTTTTTAA, downstream forward: _UP4_TAAGAATGAGGGAAAAAAGCLabs working on this gene/protein
[SW|Charles Moran], Emory University, NC, USA [http://www.microbiology.emory.edu/moran_c.html homepage]References
Reviews
Original publications
15752199,18485064,15574594,18812514,1766372,17693505,19609349,17121846,21097616,22431613,22171814,23834622,22431604,23859254,25356555,26735940,27381174,27681621