perR [2018-05-09 09:54:41]

transcriptional repressor of the peroxide regulon, sensor of the intracellular Fe/Mn ratio

locus: BSU08730

pI: 5.89

mw: 16.28 kDa

protein length: 145 aa

gene length: 435 bp

function: regulation of the response to peroxide

product: transcriptional repressor (Fur family)

essential: no

synonyms: ygaG

Genomic Context

categories

• [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
• [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]

Gene

Coordinates: 944,487 → 944,924

Phenotypes of a mutant

• resistant to hydrogen peroxide, accumulates a porphyrin-like compound, and grows very slowly (due to heme sequestration by [protein|B0A1AB6E920E6CBEE45115297599AF9A80972E38|KatA]) [Pubmed|22194458]

The protein

Protein family

• [SW|Fur family]

Paralogous protein(s)

• [protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur], [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]

Modification

• selective metal catalyzed oxidation of two histidine residues of the regulatory site results in induction (loss of DNA-binding activity) [Pubmed|19508285]

[SW|Cofactors]

• contains an Fe²⁺ at the regulatory site and Zn²⁺ [Pubmed|22797754]

Effectors of protein activity

• responds to the presence of hydrogen peroxide [pubmed|29738773]

Structure

• [PDB|2RGV] [PDB|3F8N]

[SW|Localization]

• cytoplasm (according to Swiss-Prot)

Expression and Regulation

Operons

• genes: [gene|00BCAAE16576DC5426A652580C69A570FC7A1C2C|perR]
  description: [Pubmed|12029044]

  sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12029044], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]

  regulatory mechanism

  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: repression, [Pubmed|12029044], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]

  regulation

  • induced in the presence of hydrogen peroxide ([protein|search|PerR]) [Pubmed|12029044]

• genes: [gene|3C139835154FA236066CF2FB82A3C32E3A72D65E|ygaF]-[gene|00BCAAE16576DC5426A652580C69A570FC7A1C2C|perR]
  description: [Pubmed|22383849]

Biological materials

Mutant

• MGNA-A258 (ygaG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/258 NBRP B. subtilis, Japan]
• HB0509 (spc), available in [SW|John Helmann]'s and [SW|Jörg Stülke]'s labs, also GP868 (''fur::mls'', ''perR::spc'').
• 1A903 ( ''perR''::''kan''), [Pubmed|12029044], available at the [http://bgsc.org/getdetail.php?bgscid=1A903 Bacillus Genetic Stock Center]
• BKE08730 (Δ[gene|D0982500E52577D52FADF775C0E512A4B9657B79|ahpC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGTCATGCACCTCTCT, downstream forward: _UP4_TAAAAATAAGCTGACCGCAC
• BKK08730 (Δ[gene|D0982500E52577D52FADF775C0E512A4B9657B79|ahpC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGTCATGCACCTCTCT, downstream forward: _UP4_TAAAAATAAGCTGACCGCAC

Labs working on this gene/protein

• [SW|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]

References

Reviews

• 19575568,19508286,20094649,20977351,22797754,25160631,26070785,26677871,28938859

Original Publications

• 8932315,18487332,14563870,16766519,17158660,12486061,11532148,12180919,16166527,15231799,12029044,10913706,21398634,9701813,16541078,12029044,11532148,12029044,19508285,22194458,23645680,23057863,23934352,25486128,26261021,27920297,27935957,28104400,11918677,29738773