perR [2019-02-19 18:18:46]

transcriptional repressor of the peroxide regulon, sensor of the intracellular Fe/Mn ratio

Locus: BSU08730

Isoelectric point: 5.89

Molecular weight: 16.28 kDa

Protein length: 145 aa

Gene length: 438 bp

Function: regulation of the response to peroxide

Product: transcriptional repressor (Fur family)

Essential: no

Synonyms: ygaG

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Regulation of gene expression → Transcription factors and their control → Transcription factors/ other
• Lifestyles → Coping with stress → Resistance against oxidative and electrophile stress

Gene

Coordinates: 944,487 944,924

Phenotypes of a mutant

• resistant to hydrogen peroxide, accumulates a porphyrin-like compound, and grows very slowly (due to heme sequestration by KatA) PubMed

The protein

Protein family

• Fur family

Paralogous protein(s)

• Zur, Fur

Modification

• selective metal catalyzed oxidation of two histidine residues of the regulatory site results in induction (loss of DNA-binding activity) PubMed

Cofactors

• contains an Fe²⁺ at the regulatory site and Zn²⁺ PubMed

Effectors of protein activity

• responds to the presence of hydrogen peroxide PubMed

Structure

• 2RGV 3F8N

Localization

• cytoplasm (according to Swiss-Prot)

Expression and Regulation

Operons

• Genes: perR
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • PerR: repression, PubMed, in PerR regulon

  Regulation

  • induced in the presence of hydrogen peroxide (PerR) PubMed

• Genes: ygaF-perR
  Description: PubMed

Biological materials

Mutant

• MGNA-A258 (ygaG::erm), available at the NBRP B. subtilis, Japan
• HB0509 (spc), available in John Helmann's and Jrg Stlke's labs, also GP868 (fur::mls, perR::spc).
• 1A903 ( perR::kan), PubMed, available at the Bacillus Genetic Stock Center
• BKE08730 (ahpC::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCCGTCATGCACCTCTCT, downstream forward: _UP4_TAAAAATAAGCTGACCGCAC
• BKK08730 (ahpC::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCCGTCATGCACCTCTCT, downstream forward: _UP4_TAAAAATAAGCTGACCGCAC

Labs working on this gene/protein

• John Helmann, Cornell University, USA Homepage

References

Reviews

Loading

Original Publications

Loading