yqgP

168

intramembrane protease

locus: BSU_24870

Molecular weight: 56.27 kDa

pI: 5.51

Protein length: 507 aa

Gene length: 1524 bp

function: cell division

product: intramembrane protease

essential: no

synonyms: yqgP, glpG, gluP

List of homologs in different organisms, belongs to COG5010 (Galperin et al., 2021)

Gene

Coordinates: 2,571,907  2,573,430

Phenotypes of a mutant

• filamentous phenotype [Pubmed|15050034]

Advertisement

The protein

Catalyzed reaction/ biological activity

• Cleaves type-1 transmembrane domains using a catalytic dyad composed of serine and histidine that are contributed by different transmembrane domains (according to UniProt)
• cleavage of [protein|472E3A2407C83EEE26DB00079D185C4EA2988611|mgtE] between its first and second trans-membrane helix at low magnesium concentration or high manganese or zinc concentrations to prevent uptake of toxic metal ions [pubmed|31930742]
• acts as adapter protein for [protein|4E7B9426CED372AA8A321A147116A3A589FBF20C|ftsH] [pubmed|31930742]

Protein family

• [wiki|peptidase S54 family] (according to UniProt)

[wiki|Domains]

• two [wiki|TPR repeat|tetratrichopeptide repeats] (according to UniProt)

Structure

• [AF|P54493]

Effectors of protein activity

• Mn²⁺ and Zn²⁺ bind to the N-terminal cytosolic domain of YqgE to stimulate [protein|472E3A2407C83EEE26DB00079D185C4EA2988611|mgtE] degradation [pubmed|31930742]

Paralogous protein(s)

• [protein|D941248711FEB7F3698AF7B02EED95722605CF72|ydcA], Array

[wiki|Localization]

• cell membrane [Pubmed|22921757]

Expression and Regulation

Operons

• genes: [gene|89C51789FBB2EE86771ABD8629FD99748ED5D4EF|yqgP]-[gene|C44F6723A2F1A627A0B9042871A07F5365D6121A|yqgO]-[gene|8E10A8B566BC25CBDDEF1503656A4234FD29ACB8|glcK]-[gene|2B33F2F9C2FB0767B72A29D060037393C88ACEE5|yqgS]

  description: [pubmed|22383849]

  additional information

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP]∼P binds to the promoter region, but regulation has not been explored [pubmed|25666134]

Biological materials

Mutant

• MGNA-C445 (yqgP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2443 NBRP B. subtilis, Japan]
• BKE24870 ([gene|89C51789FBB2EE86771ABD8629FD99748ED5D4EF|yqgP]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE24870 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTACCGCTCCAATAG,  downstream forward: _UP4_TAGAGGTGGAATATGGAAAG
• BKK24870 ([gene|89C51789FBB2EE86771ABD8629FD99748ED5D4EF|yqgP]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK24870 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTACCGCTCCAATAG,  downstream forward: _UP4_TAGAGGTGGAATATGGAAAG

References

Reviews

• 19421188,23518036,34410368,37948297

Original Publications

• 15050034,22921757,15616571,31930742