PMAD

From SubtiWiki
Jump to: navigation, search
pMAD: click to enlarge

General comments

A plasmid for generating gene inactivation mutants in naturally nontransformable gram-positive bacteria. This vector allows, on X-Gal (5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside) plates, a quick colorimetric blue-white discrimination of bacteria which have lost the plasmid, facilitating clone identification during mutagenesis. The plasmid is can be used in Staphylococcus aureus, Listeria monocytogenes, and Bacillus spp. to efficiently construct mutants with or without an associated antibiotic resistance gene.

  • E.coli: multicopy plasmid, select for ampicillin
  • B. subtilis: temperature-sensitive ori, select for erythromycin/ lincomycin

Hints for the usage

  • for a markerless deletion of a gene amplify 1000 bp up- and downstream of the gene and clone them into the MCS of the plasmid

The reference

Maryvonne Arnaud, Arnaud Chastanet, Michel Débarbouillé
New vector for efficient allelic replacement in naturally nontransformable, low-GC-content, gram-positive bacteria.
Appl. Environ. Microbiol.: 2004, 70(11);6887-91
[PubMed:15528558] [WorldCat.org] [DOI] (P p)


Sequencing oligos

  • JG138 pMAD seq fwd: GCAACGCGGGCATCCCGATG
  • JG139 pMAD seq fwd: CCCAATATAATCATTTATCAACTCTTTTACACTTAAATTTCC

The sequence

  • GAATTAATTCTCATGTTTGACAGCTTATCATCGATTCACAAAAAATAGGC

ACACGAAAAACAAGTTAAGGGATGCAGTTTATGCATCCCTTAACTTACTT ATTAAATAATTTATAGCTATTGAAAAGAGATAAGAATTGTTCAAAGCTAA TATTGTTTAAATCGTCAATTCCTGCATGTTTTAAGGAATTGTTAAATTGA TTTTTTGTAAATATTTTCTTGTATTCTTTGTTAACCCATTTCATAACGAA ATAATTATACTTTTGTTTATCTTTGTGTGATATTCTTGATTTTTTTCTAC TTAATCTGATAAGTGAGCTATTCACTTTAGGTTTAGGATGAAAATATTCT CTTGGAACCATACTTAATATAGAAATATCAACTTCTGCCATTAAAAGTAA TGCCAATGAGCGTTTTGTATTTAATAATCTTTTAGCAAACCCGTATTCCA CGATTAAATAAATCTCATTAGCTATACTATCAAAAACAATTTTGCGTATT ATATCCGTACTTATGTTATAAGGTATATTACCATATATTTTATAGGATTG GTTTTTAGGAAATTTAAACTGCAATATATCCTTGTTTAAAACTTGGAAAT TATCGTGATCAACAAGTTTATTTTCTGTAGTTTTGCATAATTTATGGTCT ATTTCAATGGCAGTTACGAAATTACACCTCTTTACTAATTCAAGGGTAAA ATGGCCTTTTCCTGAGCCGATTTCAAAGATATTATCATGTTCATTTAATC TTATATTTGTCATTATTTTATCTATATTATGTTTTGAAGTAATAAAGTTT TGACTGTGTTTTATATTTTTCTCGTTCATTATAACCCTCTTTAATTTGGT TATATGAATTTTGCTTATTAACGATTCATTATAACCACTTATTTTTTGTT TGGTTGATAATGAACTGTGCTGATTACAAAAATACTAAAAATGCCCATAT TTTTTCCTCCTTATAAAATTAGTATAATTATAGCACGAGCTCTGATAAAT ATGAACATGATGAGTGATCGTTAAATTTATACTGCAATCGGATGCGATTA TTGAATAAAAGATATGAGAGATTTATCTAATTTCTTTTTTCTTGTAAAAA AAGAAAGTTCTTAAAGGTTTTATAGTTTTGGTCGTAGAGCACACGGTTTA ACGACTTAATTACGAAGTAAATAAGTCTAGTGTGTTAGACTTTATGAAAT CTATATACGTTTATATATATTTATTATCCGGAGGTGTAGCATGTCTCATT CAATTTTGAGGGTTGCCAGAGTTAAAGGATCAAGTAATACAAACGGGATA CAAAGACATAATCAAAGAGAGAATAAAAACTATAATAATAAAGACATAAA TCATGAGGAAACATATAAAAATTATGATTTGATTAACGCACAAAATATAA AGTATAAAGATAAAATTGATGAAACGATTGATGAGAATTATTCAGGGAAA CGTAAAATTCGGTCAGATGCAATTCGACATGTGGACGGACTGGTTACAAG TGATAAAGATTTCTTTGATGATTTAAGCGGAGAAGAAATAGAACGATTTT TTAAAGATAGCTTGGAGTTTCTAGAAAATGAATACGGTAAGGAAAATATG CTGTATGCGACTGTCCATCTGGATGAAAGAGTCCCACATATGCACTTTGG TTTTGTCCCTTTAACAGAGGACGGGAGATTGTCTGCAAAAGAACAGTTAG GCAACAAGAAAGACTTTACTCAATTACAAGATAGATTTAATGAGTATGTG AATGAGAAAGGTTATGAACTTGAAAGAGGCACGTCCAAAGAGGTTACAGA ACGAGAACATAAAGCGATGGATCAGTACAAGAAAGATACTGTATTTCATA AACAGGAACTGCAAGAAGTTAAGGATGAGTTACAGAAGGCAAATAAGCAG TTACAGAGTGGAATAGAGCATATGAGGTCTACGAAACCCTTTGATTATGA AAATGAGCGTACAGGTTTGTTCTCTGGACGTGAAGAGACTGGTAGAAAGA TATTAACTGCTGATGAATTTGAACGCCTGCAAGAAACAATCTCTTCTGCA GAACGGATTGTTGATGATTACGAAAATATTAAGAGCACAGACTATTACAC AGAAAATCAAGAATTAAAAAAACGTAGAGAGAGTTTGAAAGAAGTAGTGA ATACATGGAAAGAGGGGTATCACGAAAAAAGTAAAGAGGTTAATAAATTA AAGCGAGAGAATGATAGTTTGAATGAGCAGTTGAATGTATCAGAGAAATT TCAAGCTAGTACAGTGACTTTATATCGTGCTGCGAGGGCGAATTTCCCTG GGTTTGAGAAAGGGTTTAATAGGCTTAAAGAGAAATTCTTTAATGATTCC AAATTTGAGCGTGTGGGACAGTTTATGGATGTTGTACAGGATAATGTCCA GAAGGTCGATAGAAAGCGTGAGAAACAGCGTACAGACGATTTAGAGATGT AGAGGTACTTTTATGCCGAGAAAACTTTTTGCGTGTGACAGTCCTTAAAA TATACTTAGAGCGTAAGCGAAAGTAGTAGCGACAGCTATTAACTTTCGGT TGCAAAGCTCTAGGATTTTTAATGGACGCAGCGCATCACACGCAAAAAGG AAATTGGAATAAATGCGAAATTTGAGATGTTAATTAAAGACCTTTTTGAG GTCTTTTTTTCTTAGATTTTTGGGGTTATTTAGGGGAGAAAACATAGGGG GGTACTACGACCTCCCCCCTAGGTGTCCATTGTCCATTGTCCAAACAAAT AAATAAATATTGGGTTTTTAATGTTAAAAGGTTGTTTTTTATGTTAAAGT GAAAAAAACAGATGTTGGGAGGTACAGTGATAGTTGTAGATAGAAAAGAA GAGAAAAAAGTTGCTGTTACTTTAAGACTTACAACAGAAGAAAATGAGAT ATTAAATAGAATCAAAGAAAAATATAATATTAGCAAATCAGATGCAACCG GTATTCTAATAAAAAAATATGCAAAGGAGGAATACGGTGCATTTTAAACA AAAAAAGATAGACAGCACTGGCATGCTGCCTATCTATGACTAAATTTTGT TAAGTGTATTAGCACCGTTATTATATCATGAGCGAAAATGTAATAAAAGA AACTGAAAACAAGAAAAATTCAAGAGGACGTAATTGGACATTTGTTTTAT ATCCAGAATCAGCAAAAGCCGAGTGGTTAGAGTATTTAAAAGAGTTACAC ATTCAATTTGTAGTGTCTCCATTACATGATAGGGATACTGATACAGAAGG TAGGATGAAAAAAGAGCATTATCATATTCTAGTGATGTATGAGGGTAATA AATCTTATGAACAGATAAAAATAATTAACAGAAGAATTGAATGCGACTAT TCCGCAGATTGCAGGAAGTGTGAAAGGTCTTGTGAGATATATGCTTCACA TGGACGATCCTAATAAATTTAAATATCAAAAAGAAGATATGATAGTTTAT GGCGGTGTAGATGTTGATGAATTATTAAAGAAAACAACAACAGATAGATA TAAATTAATTAAAGAAATGATTGAGTTTATTGATGAACAAGGAATCGTAG AATTTAAGAGTTTAATGGATTATGCAATGAAGTTTAAATTTGATGATTGG TTCCCGCTTTTATGTGATAACTCGGCGTATGTTATTCAAGAATATATAAA ATCAAATCGGTATAAATCTGACCGATAGATTTTGAATTTAGGTGTCACAA GACACTCTTTTTTCGCACCAGCGAAAACTGGTTTAAGCCGACTGCGCAAA AGACATAATCGATAAGCTTTAATGCGGTAGTTTATCACAGTTAAATTGCT AACGCAGTCAGGCACCGTGTATGAAATCTAACAATGCGCTCATCGTCATC CTCGGCACCGTCACCCTGGATGCTGTAGGCATAGGCTTGGTTATGCCGGT ACTGCCGGGCCTCTTGCGGGATCGAGGCCTTTAGCATATTATGTTGCCAA CTGTCGGAACGAGACTTCTCTAAACCTTCCCGGCTTCATCATGCTCTCTT AACACTGCTACATCAACCCCTTGAATCCTCAATTCACCTCCTCGAAAACA TTTCCCATCAATCATATTCTGGTATATCTTATCTTCTGGCAGTGACAGCG TCACTTCGTAATCATTATGATTGATGATAATCAAATACTTCCATTCATCA GTCTCTCTTTGTTGCACCTCTACATTTTCAGCTACTTCAAGAATGGGATT AATATGATGTTTAGCGAAAACCTGTTCTAAAAGCCTGCCTAAATAATTAC TATCTGGATAAGTACCGACGTAAATCCCCTCTCCTTTACCGTAGCAGTTA CGTGTAACCGCCGGAAGTCCTGCATACCAATCCCCCTTAAATGTCGCTAG AGGTTCTGCCCCTTCTAATCGGATTATGTCCGCCCACGTCGTACAATCAT ATTCCCCATCGTTACTATATATTTTGTTTACCTTTGTTTCTGGGTATGGT ACAAATTCCTCAACAAAAATCCCCAAAATATCTCGCAGAGGACCAGGATA TCCGCCTAGATGTACACGGTCATTTTCATCTACAATGCCACTGAAGAAAC TGACAATCAAAGTGCCACCGTTAGCAACAAATTGCCGTAAGTTTTCATCT TCTCCCTCTTTAACCATATATAACATTGGAGCAATAACTACTTTGTATTT TGTTAGATCATCAGATGGCCTTACAAAATCGACAGCAATATTACGTTTAT ATAATTCCCTATAATAAGCTTCAACTATAGGAATATATCTTAGTTTATTA TGTGGTTTGGAACTTAGTTCGACAGCCCACCAGTTTTCCCAATCAAAAAT GATCGCGACCTCTGCCTTGATTCTAGATCCGACCAAACAATCTAACTTTT TCAGCTCTTGCCCTAACTGTGTAACTTCCCTATAAATTCTATTATTCTCG TTCAAAAAGTGGGGCACCATTGCACCGTGGAATTTTTCAGCTCCTGCTCT ACTTTGACGCCACTGGAAAAACATAATACCATCTGCACCACGGGCAATAG TTGCATAACTCCATAGACGCATTACACCTGGCGGTTTTGGAACATTAATA TCGCGCCAGTTAACATGTGAGGTTACCTGCTCCATCAAAATAAACGGTTG ACCTTTTCTTAAACTACGCATAAGGTCATTCATCATGGCGTGCTGAATTG GCAAGCCCTCTCTGGGATCAGGATATGAGTCCCATGTCACAATATCTACA TGCTGAGCCCATTGAAAATAGTTTAACGGTTTGAATGAACCCATGAAATT AGTTGATACTGGAATATCTGGTGTTACCTCACGTAAAATTTCCTTTTCTG TTAAAAACAACTTGAGAATTGAGTCATTCATAAAACGGTAGTAATCAAGT TCTTGGGATGGATTAATAAAAGTTGGTGCCTTTCTAGGGGGATTAATTTC ATCCCAATGATTGTATCGCTGTCCCCAAAAGTTTGTACCCCAACGTTCAT TTAATTCATCGATTGTTTTATATCTTTCCTTTAGCCACTTTCTAAACGCG ACAGCACAATTCTCACAAAAACACTTGGAAACGTGACATGCATACTCATT ATTAACATGCCACATTTTGAGTGCCGGATGATTTTTATACCGTTCTGCTA TAGCCCTCACAAGTCTCTTTATGTGCGTAATTAATTGAGGATGATTAGGA CAATAATGTTGTCTACTGCCAAACGAGAGAATGACACCGCTTTCATCGAT CGGCAAAGAATCTGGATACTTTTTTACAAACCAAGCTGGAGTAGTTGCAG TCGCCGTCCCCAAGTTAATATAAACACCGTGGTCATATAGTATATCTATA ACCTTGTCTAGCCATTCAAAGTCGAACACTCCATCAGACGGTTCGATCTT GCTCCAACTGAAAATCCCTAAAGATACTAAATTCACCCCCGCTTTTTGCA TCAACTTAGCATCTTCATACCAAATTTCCTCTGGCCATTGCTCTGGGTTA TAATCTCCTCCGTAACAAATTGAGGATAACACATTCATAATTATTCCCCC TAGCTAATTTTCGTTTAATTATAAATTAAGTTAAAATTTAGGTACCTACG TAGGATCGATCCGATCCTTAATTATATTATAGTCCCAATATAATCATTTA TCAACTCTTTTACACTTAAATTTCCTAATATTTGTAAATATTTTTTTGAA TAAAAAAATCTAGCTAATGTTACGTTACACATTAACTAGACAGATCTATC GATGCATGCCATGGTACCCGGGAGCTCGAATTCTAGAAGCTTCTGCAGAC GCGTCGACGTCATATGGATCCGATATCGCCCGACGCGAGGCTGGATGGCC TTCCCCATTATGATTCTTCTCGCTTCCGGCGGCATCGGGATGCCCGCGTT GCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTC AAGGATCGCTCGCGGCTCTTACCAGCCTAACTTCGATCACTGGACCGCTG ATCGTCACGGCGATTTATGCCGCCTCGGCGAGCACATGGAACGGGTTGGC ATGGATTGTAGGCGCCGCCCTATACCTTGTCTGCCTCCCCGCGTTGCGTC GCGGTGCATGGAGCCGGGCCACCTCGACCTGAATGGAAGCCGGCGGCACC TCGCTAACGGATTCACCACTCCAAGAATTGGAGCCAATCAATTCTTGCGG AGAACTGTGAATGCGCAAACCAACCCTTGGCAGAACATATCCATCGCGTC CGCCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCT GGCCACGGGTGCGCATGATCGTGCTCCTGTCGTTGAGGACCCGGCTAGGC TGGCGGGGTTGCCTTACTGGTTAGCAGAATGAATCACCGATACGCGAGCG AACGTGAAGCGACTGCTGCTGCAAAACGTCTGCGACCTGAGCAACAACAT GAATGGTCTTCGGTTTCCGTGTTTCGTAAAGTCTGGAAACGCGGAAGTCA GCGCCCTGCACCATTATGTTCCGGATCTGCATCGCAGGATGCTGCTGGCT ACCCTGTGGAACACCTACATCTGTATTAACGAAGCGCTGGCATTGACCCT GAGTGATTTTTCTCTGGTCCCGCCGCATCCATACCGCCAGTTGTTTACCC TCACAACGTTCCAGTAACCGGGCATGTTCATCATCAGTAACCCGTATCGT GAGCATCCTCTCTCGTTTCATCGGTATCATTACCCCCATGAACAGAAATT CCCCCTTACACGGAGGCATCAAGTGACCAAACAGGAAAAAACCGCCCTTA ACATGGCCCGCTTTATCAGAAGCCAGACATTAACGCTTCTGGAGAAACTC AACGAGCTGGACGCGGATGAACAGGCAGACATCTGTGAATCGCTTCACGA CCACGCTGATGAGCTTTACCGCAGCTGCCTCGCGCGTTTCGGTGATGACG GTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTG TAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGT TGGCGGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAG TGTATACTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGC ACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGC ATCAGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGT TCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTAT CCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAG CAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAG GCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGT GGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGC TCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTC CGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTA GGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCAC GAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCT TGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTG GTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTG AAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTG CGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGAT CCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAG CAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTC TACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGG TCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAA TGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAG TTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTC GTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGG GAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACG CTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCG AGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAAT TGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAA CGTTGTTGCCATTGCTGCAGGCATCGTGGTGTCACGCTCGTCGTTTGGTA TGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCC CCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGT CAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGC ATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGT GAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTG CTCTTGCCCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTT TAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGG ATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAA CTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAA CAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGT TGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGG TTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAAC AAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAA GAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAG GCCCTTTCGTCTTCAA

Return to Plasmids