mcpB

168

membrane-bound chemotaxis receptor, methyl-accepting chemotaxis protein, receptor for asparagine as well as ethanol and other short-chain alcohols, acts also as pH sensor, responds to increasing pH as an attractant signal

locus: BSU_31260

Molecular weight: 71.70 kDa

pI: 5.13

Protein length: 662 aa

Gene length: 1989 bp

function: control of chemotaxis, sensing of different compounds

product: methyl-accepting chemotaxis protein

essential: no

synonyms: mcpB

List of homologs in different organisms, belongs to COG0840 (Galperin et al., 2021)

Gene

Coordinates: 3,210,445 → 3,212,433

Advertisement

The protein

[wiki|Domains]

• [wiki|Cache domain] (aa 153-229) (according to UniProt)
• [wiki|HAMP domain] (aa 304-356) (according to UniProt)
• [wiki|Methyl-accepting transducer domain] (aa 375-611) (according to UniProt)

Structure

• [PDB|6S1K] (from E. coli, corresponds to aa 280 ... 545, 33% identity) [pubmed|31925330]
• [AF|P39215]

Modification

• methylated at residues Gln371, Glu630, and Glu637 [Pubmed|20864474]

Effectors of protein activity

• asparagine (binds to the part of McpB that is exposed to the exterior) [Pubmed|19864420]

Kinetic information

• K(D) for asparagine: 14 myM [Pubmed|19864420]

Paralogous protein(s)

• [protein|F02E3080214A327E131ECDE0DBC52C57EFDFE2CE|mcpA], [protein|4CD44AD8FE68516C84889EAA2137828E06B8A30B|tlpB], [protein|1DE26CDEE952142C1303C822F0E2A63AE09F721B|tlpA], [protein|8333CD46F704F03A22482CAA98DEFCC945362A10|mcpC]

[wiki|Localization]

• cell membrane [Pubmed|18763711,21515776]
• localized at the cell poles, but in the presence of high asparagine concentration there is a reversible re-localization to the sides of the cell (lateral clusters) [Pubmed|21098025]

Expression and Regulation

Operons

• genes: [gene|E4E1020B799A1B403BDB4847B91B02D64D161AF3|mcpB]

  description: [Pubmed|8188684]

  sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|8188684], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]

  additional information

  • in minimal medium, McpB is present with 6,200 /- 1,900 molecules per cell [PubMed|21515776]

Biological materials

Mutant

• BKE31260 (Δ[gene|E4E1020B799A1B403BDB4847B91B02D64D161AF3|mcpB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE31260 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCACTTGCTCCTTCAG,  downstream forward: _UP4_TAAAAACCGAAAAACAGCGC
• BKK31260 (Δ[gene|E4E1020B799A1B403BDB4847B91B02D64D161AF3|mcpB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK31260 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCACTTGCTCCTTCAG,  downstream forward: _UP4_TAAAAACCGAAAAACAGCGC

References

Reviews

• 31792011,35323015

Original Publications

• 36815589,11722727,10825179,8251536,12909020,10196193,15544802,6137212,9194713,2505839,8188684,2105313,12123464,14731274,20864474,18763711,19864420,21098025,21515776,25039821,27899502,31685537,31925330,33024039