ywqL

168

endonuclease V (endo V)

locus: BSU_36170

Molecular weight: 26.83 kDa

pI: 5.71

Protein length: 238 aa

Gene length: 717 bp

function: DNA excision repair

product: endonuclease V

essential: no

synonyms: ywqL

List of homologs in different organisms, belongs to COG1515 (Galperin et al., 2021)

Gene

Coordinates: 3,724,420 → 3,725,136

Phenotypes of a mutant

• increased mutation rates [Pubmed|22056936]
• increased sensitivity of sporulating cells to the genotoxic effects of nitrous acid[Pubmed|27698084]
• increased mutation rates [pubmed|30726292]

Advertisement

The protein

Catalyzed reaction/ biological activity

• Endonucleolytic cleavage at apurinic or apyrimidinic sites to products with a 5'-phosphate (according to UniProt)
• in vitro endonuclease activity against double-stranded DNAs containing a single uracil (U), hypoxanthine (Hx), xanthine (X) or an AP site [pubmed|30726292]
• catalyzes a single strand break at the second phosphodiester bond towards the 3'-end of the U and AP lesions [pubmed|30726292]

Protein family

• endonuclease V family (single member, according to UniProt)

Structure

• [PDB|3GA2]
• [AF|P96724]

[wiki|Localization]

• cytoplasm (according to Swiss-Prot)

Biological materials

Mutant

• MGNA-A566 (ywqL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/566 NBRP B. subtilis, Japan]
• BKE36170 (Δ[gene|F2C6956D69FBE57933E46136436E8E80B63DF8BB|ywqL]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE36170 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATCAAATACCTTCATAACGA,  downstream forward: _UP4_TAACACTTGGGGCTCTAAGT
• BKK36170 (Δ[gene|F2C6956D69FBE57933E46136436E8E80B63DF8BB|ywqL]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK36170 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATCAAATACCTTCATAACGA,  downstream forward: _UP4_TAACACTTGGGGCTCTAAGT

References

Reviews

• 35210609,38551349

Research papers

• 9353933,22056936,22383849,27530626,27698084,30726292,35847079