hpf

168

general stress protein, required for ribosome dimerization in the stationary phase, protects essential ribosomal proteins ([protein|F1969E4C7BAAF70BCBE570F58350C12A3E417539|S2] and [protein|E7F4E01A6005C8469EAC64E8DFED96D0F29791A9|S3])

locus: BSU_35310

Molecular weight: 21.83 kDa

pI: 5.18

Protein length: 189 aa

Gene length: 570 bp

function: protection of essential ribosomal proteins ([protein|F1969E4C7BAAF70BCBE570F58350C12A3E417539|S2] and [protein|E7F4E01A6005C8469EAC64E8DFED96D0F29791A9|S3])

product: ribosome hibernation promoting factor

essential: no

synonyms: hpf, yviI, yvyD

List of homologs in different organisms, belongs to COG1544 (Galperin et al., 2021)

Gene

Coordinates: 3,631,003  3,631,572

Phenotypes of a mutant

• the mutant is cold-sensitive
• delayed recovery from stationary phase and delayed [wiki|germination] [Pubmed|26743942]

Advertisement

The protein

Catalyzed reaction/ biological activity

• [protein|search|Hpf ]binds the 30S subunits of hibernating [wiki|ribosome]s, dimerization of [protein|search|Hpf ]results in 100S [wiki|ribosome ]dimer formation [pubmed|28468753,26743942]

Protein family

• HPF/YfiA ribosome-associated protein family (single member, according to UniProt)

Structure

• [PDB|2YWQ] (N-terminal domain, from ''Thermus thermophilus'', 32% identity)
• [PDB|3K2T] (C-terminal domain, from ''Listeria monocytogenes'', 75% identity)
• [PDB|5NJT] (Hpf as part of the 100S [wiki|ribosome]) [pubmed|28468753]
• [AF|P28368]

Modification

• phosphorylated on Arg-6 [Pubmed|22517742]

[wiki|Localization]

• cytoplasm (according to UniProt)

Biological materials

Mutant

• BKE35310 ([gene|37B8B671B84266A7D65B90A9077A0DFF458D1851|hpf]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE35310 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCAAAGAACGCCTCCCTT,  downstream forward: _UP4_TAATGAAGAGAAGCCTTCCG
• BKK35310 ([gene|37B8B671B84266A7D65B90A9077A0DFF458D1851|hpf]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK35310 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCAAAGAACGCCTCCCTT,  downstream forward: _UP4_TAATGAAGAGAAGCCTTCCG
• GP2598 ([gene|37B8B671B84266A7D65B90A9077A0DFF458D1851|hpf]::tet comIQ12L) (in DK1042) available in [wiki|Jörg Stülke]'s lab

References

• 36815589,22517742,26743942,9852014,15805528,25666134,12107147,23663662,28468753,28468753,30619132,31604775,32123037