ylmE

168

pyridoxal phosphate-binding protein, involved in controlling the availability of coenzyme A

locus: BSU_15380

Molecular weight: 25.56 kDa

pI: 5.55

Protein length: 230 aa

Gene length: 693 bp

function: control of the CoA pool

product: pyridoxal phosphate-binding protein

essential: no

synonyms: ylmE

List of homologs in different organisms, belongs to COG0325 (Galperin et al., 2021)

Gene

Coordinates: 1,610,170  1,610,862

Advertisement

The protein

Catalyzed reaction/ biological activity

• while the protein was described as an amino acid racemase important for biofilm formation [Pubmed|20431016], no racemase activity was detected in ''in vitro'' assays with a functionally active protein [Pubmed|24097949]

Protein family

• pyridoxal phosphate-binding protein YggS/PROSC family (single member, according to UniProt)

[wiki|Cofactors]

• pyridoxal phosphate [Pubmed|24097949]

Structure

• [PDB|1W8G] (the structure of YggS from ''E. coli'' 33% identity, 61% similarity)
• [AF|O31727]

Biological materials

Mutant

• MGNA-B363 (ylmE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1362 NBRP B. subtilis, Japan]
• BKE15380 ([gene|31789A170CB624BF8210C915F40007F802F5C81B|ylmE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE15380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATTATCAACAACACGCAAGA,  downstream forward: _UP4_AATGAAACAGGGGGTGTACA
• BKK15380 ([gene|31789A170CB624BF8210C915F40007F802F5C81B|ylmE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK15380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATTATCAACAACACGCAAGA,  downstream forward: _UP4_AATGAAACAGGGGGTGTACA

References

• 14651647,16420366,24097949,26872910,30902856,32900832