yabR

168

similar to the C-terminal domain of E. coli polyribonucleotide phosphorylase and to four repeated domains at the N-terminus of E. coli ribosomal protein S1

locus: BSU_00630

Molecular weight: 14.05 kDa

pI: 10.34

Protein length: 128 aa

Gene length: 387 bp

function: unknown

product: unknown

essential: no

synonyms: yabR

List of homologs in different organisms, belongs to COG1098 (Galperin et al., 2021)

Gene

Coordinates: 69,626  70,012

Phenotypes of a mutant

• defective in [category|SW.4.1.4|Swarming] motility [pubmed|35638827]

Advertisement

The protein

Protein family

• Peptidase U57 family (together with [protein|A46D07F8F56249A04C5F880120D19F00C9CAE112|yabG]) (according to UniProt)

[wiki|Domains]

• [wiki|S1 domain] (aa 4 ... 74) (according to the Interpro database)

Structure

• [PDB|2K4K] ([protein|B0908BB4B8B569A7A78BB0B84784FD4C427C598B|yugI], 51% identity from aa 3 ... 91) [pubmed|19152054]
• [AF|P37560]

Paralogous protein(s)

• [protein|B0908BB4B8B569A7A78BB0B84784FD4C427C598B|yugI], Array

Biological materials

Mutant

• GP3598 (Δ[gene|8EDB1BCEEE64FDAF1C9054300751FCB420658865|yabR]::''kan''), available in [wiki|Jörg Stülke]'s lab
• GP3309 (Δ[gene|B0908BB4B8B569A7A78BB0B84784FD4C427C598B|yugI]::''tet'') (Δ[gene|8EDB1BCEEE64FDAF1C9054300751FCB420658865|yabR]::''aphA3''), available in [wiki|Jörg Stülke]'s lab
• GP3314 ([gene|search|''yabR-FLAG''] ''spec''), available in [wiki|Jörg Stülke]'s lab
• GP3315 ([gene|search|''yabR-His''] ''spec''), available in [wiki|Jörg Stülke]'s lab
• MGNA-B919 (yabR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1918 NBRP B. subtilis, Japan]
• BKE00630 ([gene|8EDB1BCEEE64FDAF1C9054300751FCB420658865|yabR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAAGTGCTCCTCC,  downstream forward: _UP4_TAACTTGCTGCTTTCTATAA
• BKK00630 ([gene|8EDB1BCEEE64FDAF1C9054300751FCB420658865|yabR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAAGTGCTCCTCC,  downstream forward: _UP4_TAACTTGCTGCTTTCTATAA

two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab

lacZ fusion

• GP3327 (based on [wiki|pAC5]) available in [wiki|Jörg Stülke]'s lab

References

Reviews

• 36882621

Original Publications

• 36815589,11283287,12207695,19152054,35638827