yaaO

168

similar to arginine decarboxylase, affects the level of [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|efp] modification

locus: BSU_00270

Molecular weight: 53.00 kDa

pI: 5.71

Protein length: 480 aa

Gene length: 1440 bp

function: control of [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|efp] modification

product: putative arginine decarboxylase

essential: no

ec: 4.1.1.19

synonyms: yaaO

List of homologs in different organisms, belongs to COG1982 (Galperin et al., 2021)

Gene

Coordinates: 37,720 → 39,162

Phenotypes of a mutant

• inactivation suppresses the swarming defect of a [gene|248F0805272FED9B38ECBB31E2872BC9EC163CE0|ymfI] mutant [pubmed|29615499]

Advertisement

The protein

Catalyzed reaction/ biological activity

• the protein was reported to be involved in norspermidine production and biofilm disassembly [Pubmed|22541437]; however, this is not the case [Pubmed|24529384] and the original paper has been [http://www.cell.com/cell/fulltext/S0092-8674(15)00495-X retracted]

Protein family

• Orn/Lys/Arg decarboxylase class-I family (together with [protein|03E5E41FD7ADA4E9CB70E312FA5F163331C92695|speA]) (according to UniProt)

[wiki|Cofactors]

• PLP (according to UniProt)

Structure

• [PDB|2X3L] (from ''Staphylococcus aureus'', 36% identity) [Pubmed|20419351]
• [AF|P37536]

Paralogous protein(s)

• [protein|03E5E41FD7ADA4E9CB70E312FA5F163331C92695|speA]

Biological materials

Mutant

• GP3961 (Δ[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]::kan), available in [wiki|Jörg Stülke]'s lab
• GP3962 (Δ[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]::phleo), available in [wiki|Jörg Stülke]'s lab
• MGNA-B896 (yaaO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1895 NBRP B. subtilis, Japan]
• BKE00270 (Δ[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00270 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAAAACAATCCTTTGAA,  downstream forward: _UP4_GTTTATATAGAAGAGGAGAA
• BKK00270 (Δ[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00270 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAAAACAATCCTTTGAA,  downstream forward: _UP4_GTTTATATAGAAGAGGAGAA

Expression vectors

• pGP3751: IPTG inducible expression, purification in ''E. coli'' with N-terminal Strep-tag, in [wiki|pGP172], available in [wiki|Jörg Stülke]'s lab
• pGP3753: expression of Strep-''yaaO'' by [wiki|pGP380] in ''B. subtilis'' suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
• pGP3754: expression of ''yaaO''-Strep by [wiki|pGP382] in ''B. subtilis'' suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
• pGP3757 (N-terminal 6xHis-SUMO-tag, purification from E. coli, in pET-SUMO), available in [wiki|Jörg Stülke]'s lab

References

• 24529384,20876533,22541437,22383849,9987136,20419351,29615499