tpi

168

triose phosphate isomerase, glycolytic/ gluconeogenic enzyme

locus: BSU_33920

Molecular weight: 26.88 kDa

pI: 4.79

Protein length: 253 aa

Gene length: 762 bp

function: enzyme in glycolysis/ gluconeogenesis

product: triosephosphate isomerase

essential: no

ec: 5.3.1.1

synonyms: tpi, tpiA

List of homologs in different organisms, belongs to COG0149 (Galperin et al., 2021)

Gene

Coordinates: 3,479,405  3,480,166

Phenotypes of a mutant

• the mutant tends to acquire suppressor mutations that result in improved growth [Pubmed|28189581]
• essential [Pubmed|12682299], non-essential according to [Pubmed|23420519]
• poor growth [pubmed|28189581]
• poorly transformable [pubmed|28189581]

Advertisement

The protein

Catalyzed reaction/ biological activity

• D-glyceraldehyde 3-phosphate --> dihydroxyacetone phosphate (according to UniProt)

Protein family

• triosephosphate isomerase family (single member,according to UniProt)

Structure

• [PDB|1BTM] (complex with 2-phosphoglycolic acid, Geobacillus stearothermophilus),  complex with 2-phosphpoglycolic acid, ''Geobacillus stearothermophilus'' [http://www.ncbi.nlm.nih.gov/Structure/mmdb/mmdbsrv.cgi?Dopt=s&uid=48255 NCBI]
• [AF|P27876]

Modification

• phosphorylation on Ser-213 [Pubmed|17218307]

Effectors of protein activity

• inhibited by 2-phosphoglycolate (in ''B. stearothermophilus'') [Pubmed|8580851]

[wiki|Localization]

• cytoplasm (homogeneously distributed throughout the cell) [Pubmed|24825009,16479537]

Additional information

• extensive information on the structure and enzymatic properties of Tpi can be found at [http://www.proteopedia.org/wiki/index.php/Triose_Phosphate_Isomerase Proteopedia]
• belongs to the 100 [http://subtiwiki.uni-goettingen.de/wiki//index.php/Most_abundant_proteins most abundant proteins] [PubMed|15378759]

Biological materials

Mutant

• GP700 (cat), available in [wiki|Jörg Stülke]'s lab, [Pubmed|23420519]
• BKK33920 ([gene|0B5E910DC94463E34ABD393E3A8F20191E4A38B2|tpi]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK33920 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTGTTCCACTTCCTTAT,  downstream forward: _UP4_GTTCAATTATTGGAGGAAGG

Expression vectors

• pGP394 (N-terminal His-tag, in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
• pGP89 (N-terminal Strep-tag, for [wiki|SPINE], expression in B. subtilis), available in [wiki|Jörg Stülke]'s lab, [pubmed|19193632]
• pGP1511 (expression in ''B. subtilis'', in [wiki|pBQ200]), available in [wiki|Jörg Stülke]'s lab

two-hybrid system

• ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab, [pubmed|19193632]

References

• 36815589,12850135,11489127,17505547,8021172,17218307,8580851,19193632,21821766,23420519,15378759,24825009,28189581