rsiW

168

anti-[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]

locus: BSU_01740

Molecular weight: 23.19 kDa

pI: 6.65

Protein length: 208 aa

Gene length: 627 bp

function: control of [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW] activity

product: anti-[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]

essential: no

synonyms: rsiW, ybbM

List of homologs in different organisms, belongs to COG5662 (Galperin et al., 2021)

Gene

Coordinates: 195,426  196,052

Advertisement

The protein

Protein family

• zinc-associated anti-sigma factor (ZAS) superfamily (with [protein|B454D14B33E2C11F0BB0A1D1BB743FA64981A966|ylaD], according to UniProt)
• anti-sigma-W factor family (single member, according to UniProt)

[wiki|Domains]

• The cytoplasmic domain is able to inactivate SigW and the extracellular and transmembrane domains are crucial for sensing and transducing the signal that triggers SigW activation (PubMed:15130127). The N-terminus binds the zinc ion and is followed by a long helix (about residues 40-80) that fits into a hydrophobic surface groove on SigW, probably blocking its ability to interact with the -10 and -35 promoter elements (PubMed:28319136).

Structure

• [PDB|5WUQ] (the cytoplasmic domain in complex with [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]) [pubmed|28319136]
• [AF|Q45588]

Effectors of protein activity

• degraded by [protein|CB50289535EA537F63BADD459BD11AA7759A6658|rasP] and [protein|EE3B6B52EA19958E2E46A1545747F5209A6AA036|prsW] under conditions of alkali shock or in the presence of antimicrobial peptides, respectively. This results in the release of [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]

[wiki|Localization]

• cell membrane (according to UniProt)

Biological materials

Mutant

• MGNA-B953 (ybbM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1952 NBRP B. subtilis, Japan]
• BKE01740 ([gene|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|rsiW]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE01740 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AGGACAGCTCATTTCATCAC,  downstream forward: _UP4_TAAAGCGCGTTAGCCGCTTT
• BKK01740 ([gene|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|rsiW]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK01740 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AGGACAGCTCATTTCATCAC,  downstream forward: _UP4_TAAAGCGCGTTAGCCGCTTT

labs

• [wiki|Thomas Wiegert], University of Bayreuth, Germany [http://www.genetik.uni-bayreuth.de/LSGenetik1/Thomas%20Wiegert-Dateien/Thomas%20Wiegert.html Homepage]

References

Reviews

• 20836086,22381678,29343670

Original Publications

• 17020587,14993308,16816000,18599827,12207695,16899079,15130127,12884008,12076816,19889088,14993308,28319136,28674070