pgk

168

phosphoglycerate kinase, glycolytic/ gluconeogenic enzyme, universally conserved protein

locus: BSU_33930

Molecular weight: 42.03 kDa

pI: 4.77

Protein length: 394 aa

Gene length: 1185 bp

function: enzyme in glycolysis/ gluconeogenesis

product: phosphoglycerate kinase

essential: No

ec: 2.7.2.3

synonyms: pgk

List of homologs in different organisms, belongs to COG0126 (Galperin et al., 2021)

Gene

Coordinates: 3,480,197 3,481,381

Phenotypes of a mutant

• the mutant tends to acquire suppressor mutations that result in improved growth [Pubmed|28189581]
• essential [Pubmed|12682299], non-essential according to [Pubmed|23420519]
• suppression of ''[gene|41872E2EF00C79918DD077F2EF78F37E24FEB110|ftsZ]''(ts) mutation (reverted by addition of pyruvate) [Pubmed|24825009]
• poor growth [pubmed|28189581]
• poorly transformable [pubmed|28189581]

Advertisement

The protein

Catalyzed reaction/ biological activity

• 3-phospho-D-glycerate + ATP --> 3-phospho-D-glyceroyl phosphate + ADP (according to UniProt)

Protein family

• phosphoglycerate kinase family (single member, according to UniProt)

[wiki|Domains]

• nucleotide binding domain (ATP) (350353)
• 2x substrate binding domain (2123), (5962)

[wiki|Cofactors]

• Mg2 or Mn2 [Pubmed|7154941]

Structure

• [PDB|1PHP] (from ''Geobacillus stearothermophilus'')
• [AF|P40924]

Modification

• phosphorylation on Ser-183 AND Thr-299 [Pubmed|17218307], [Pubmed|17726680]

Effectors of protein activity

• Inhibited by Co2 , NDP and NMP [Pubmed|7154941]

Kinetic information

• Two Substrate Reversible Michaelis-Menten [Pubmed|7154941]

Additional information

• extensive information on the structure and enzymatic properties of Pgk can be found at [http://www.proteopedia.org/wiki/index.php/Phosphoglycerate_Kinase Proteopedia]
• belongs to the 100 most abundant proteins [PubMed|15378759]

Biological materials

Mutant

• GP699 (''pgk''::''cat''), available in [wiki|Jrg Stlke]'s lab, [Pubmed|23420519]lab
• GP707 (''pgk''::''erm''), available in [wiki|Jrg Stlke]'s lab, [Pubmed|23420519]
• BKK33930 ([gene|ECF0F2E906BF94F509817752827CA189AFBE53FE|pgk]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK33930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCTAGGAGATCCTCCT, downstream forward: _UP4_TAATCTCAAAACTGCTATAA

Expression vectors

• pGP1102 (N-terminal His-tag, in [wiki|pWH844]), available in [wiki|Jrg Stlke]'s lab
• pGP95 (N-terminal Strep-tag, in [wiki|pGP172]), available in [wiki|Jrg Stlke]'s lab
• pGP91 (N-terminal Strep-tag, for [wiki|SPINE], expression in ''B. subtilis'', in [wiki|pGP380]), available in [wiki|Jrg Stlke]'s lab, [pubmed|19193632]
• pGP1513 (expression in ''B. subtilis'', in [wiki|pBQ200]), available in [wiki|Jrg Stlke]'s lab

two-hybrid system

• ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available iin [wiki|Jrg Stlke]'s lab, [pubmed|19193632]

lacZ fusion

• pGP514 (in [wiki|pAC6]), a series of promoter deletion variants is also available in [wiki|pAC6], available in [wiki|Jrg Stlke]'s lab

References

• 36815589,16479537,12850135,17726680,11489127,17505547,17218307,7154941,12682299,23420519,15378759,24825009,28189581