pdhD

168

dihydrolipoamide dehydrogenase E3 subunit of both pyruvate dehydrogenase and 2-oxoglutarate dehydrogenase complexes

locus: BSU_14610

Molecular weight: 49.57 kDa

pI: 4.76

Protein length: 470 aa

Gene length: 1413 bp

function: links glycolysis and TCA cycle, enzyme in TCA cycle

product: dihydrolipoamide dehydrogenase E3 subunit of both pyruvate dehydrogenase and 2-oxoglutarate dehydrogenase complexes

essential: no

ec: 1.8.1.4

synonyms: pdhD, citL

List of homologs in different organisms, belongs to COG1249 (Galperin et al., 2021)

Gene

Coordinates: 1,531,870 1,533,282

Phenotypes of a mutant

• defects in sporulation and unable to grow on glucose as single carbon source [Pubmed|11976308]

Advertisement

The protein

Catalyzed reaction/ biological activity

• Protein N⁶-(dihydrolipoyl)lysine + NAD⁺ --> protein N⁶-(lipoyl)lysine + NADH₂ (according to UniProt)

Protein family

• class-I pyridine nucleotide-disulfide oxidoreductase family (with [protein|2ECF05AEE1549861EB3AE62139F0E9DEE0B0F632|acoL] and [protein|1FD06CB6E81C920EFC656DBE2A13D68B1AA68872|lpdV], according to UniProt)

[wiki|Cofactors]

• FAD (according to UniProt)

Structure

• [PDB|1EBD] (complex with binding domain of dihydrolipoamide acetylase, Geobacillus stearothermophilus), [PDB|1EBD] (complex with binding domain of dihydrolipoamide acetylase, ''Geobacillus stearothermophilus'')
• [AF|P21880]

Modification

• phosphorylated (Ser/Thr/Tyr) [Pubmed|17726680]

Effectors of protein activity

• Inhibited thiamine 2-thiothiazolone diphosphate and NADH [Pubmed|6414463]
• Low sensibility to NADPH [Pubmed|6414463]

Kinetic information

• Michaelis-Menten [Pubmed|6414463]

Paralogous protein(s)

• [protein|1FD06CB6E81C920EFC656DBE2A13D68B1AA68872|lpdV], [protein|2ECF05AEE1549861EB3AE62139F0E9DEE0B0F632|acoL]

[wiki|Localization]

• cytoplasm (according to UniProt)

Additional information

• belongs to the 100 most abundant proteins [PubMed|15378759]

Biological materials

Mutant

• BKE14610 ([gene|E9BBAE86DF3E536A987179CC394B472F6F710498|pdhD]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE14610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGGAAATCTCCTACTACCA, downstream forward: _UP4_TAATTTTCATATCAAAAACA
• BKK14610 ([gene|E9BBAE86DF3E536A987179CC394B472F6F710498|pdhD]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK14610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGGAAATCTCCTACTACCA, downstream forward: _UP4_TAATTTTCATATCAAAAACA

two-hybrid system

• ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jrg Stlke]'s lab

FLAG-tag construct

• GP1427 (spc, based on [wiki|pGP1331]), available in the [wiki|Jrg Stlke]'s lab

lacZ fusion

• pGP723 (in [wiki|pAC5]), available in [wiki|Jrg Stlke]'s lab

References

Reviews

• 19476487,9655937,2227213,6805383,10672230,24798336

Original Publications

• 12850135,6414463,11976308,17726680,20081037,20933603,24204596,15378759,36815589,