mbl

168

cell shape-determining protein, forms filaments, the polymers control/restrict the mobility of the cell wall elongation enzyme complex, required for [protein|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO] activity

locus: BSU_36410

Molecular weight: 35.70 kDa

pI: 5.67

Protein length: 333 aa

Gene length: 1002 bp

function: [wiki|cell shape] determination

product: [protein|A4C8719E06F774A6EB4D79757CC79CF89E453A54|mreB]-like protein

essential: yes

synonyms: mbl

List of homologs in different organisms, belongs to COG1077 (Galperin et al., 2021)

Gene

Coordinates: 3,747,254  3,748,255

Phenotypes of a mutant

• essential [Pubmed|28189581]
• non-viable in the absence of low Mg²⁺, growth can be rescued by the addition of mirubactin C [pubmed|36312962]
• readily accumulate [gene|D6C2B8ABBBD1F9F2D36C34098D5B811A15C60D3B|rsgI] suppressor mutants [Pubmed|19114499]
• the growth defect of the mutant can be suppressed by over expression of [protein|4385EA135BDEB54B33C9A8E39150A60C83C0CEEA|mprF] [pubmed|36744964]
• the growth defect can be rescued by iron-chelating compounds or by reducing the iron content in the medium [pubmed|37433811]
• the growth defect can be rescued by overexpression of [gene|D52FDB5015B10E9B26D7FED5708457890C6EA43D|murG] [pubmed|37433811]

Advertisement

The protein

Catalyzed reaction/ biological activity

• forms helical filaments in a heterologous system [Pubmed|21091501]
• required for [protein|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO] activity [Pubmed|23869552]

Protein family

• [wiki|FtsA/MreB family] (according to UniProt)

Structure

• [PDB|1JCF] ([protein|A4C8719E06F774A6EB4D79757CC79CF89E453A54|mreB] from ''Thermotoga maritima'', 52% identity) [Pubmed|11544518]
• [AF|P39751]

Paralogous protein(s)

• [protein|A4C8719E06F774A6EB4D79757CC79CF89E453A54|mreB], [protein|40829C3632E9DCEB9E1C14A674B4B217F504CFE0|mreBH]

[wiki|Localization]

• during logarithmic growth, [protein|6ED386D49F973C1F6B1076974F54275DD583C9D3|mbl] forms discrete patches that move processively along peripheral tracks perpendicular to the cell axis [Pubmed|21636744]
• forms transverse bands as cells enter the stationary phase [Pubmed|21636744]
• close to the inner surface of the cytoplasmic membrane [Pubmed|16950129]
• reports on helical structures formed by Mbl [Pubmed|16950129,20566861] seem to be misinterpretation of data [Pubmed|21636744]
• Mbl patch speed depends on the growth rate, the faster growth, the higher the patch speed [pubmed|28589952]

Expression and Regulation

additional information

• the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]

Biological materials

Mutant

• BKE36410 ([gene|6ED386D49F973C1F6B1076974F54275DD583C9D3|mbl]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE36410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTATTTATATCCTCCTT,  downstream forward: _UP4_TGATTTCACAAACCTCATTC

two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab

Antibody

• available in the [wiki|Jeff Errington]'s and [wiki|Peter Graumann]'s labs

labs

• [wiki|Peter Graumann], Freiburg University, Germany [http://www.biologie.uni-freiburg.de/data/bio2/graumann/index.htm homepage]

References

Original Publications

• 36815589,19643765,16832063,11290328,12809607,16101995,12530960,7836311,16950129,9023218,19659933,19114499,21091501,20525796,22048160,22343529,23879732,23869552,26091431,22383849,27215790,28189581,28589952,26883633,36312962,36744964,37433811,38047707

Localization

• 17064365,20566861,21636744,21636745,22069484,29203279,33148162