fliF

168

flagellar basal-body M-ring protein, membrane anchor of the basal body

locus: BSU_16210

Molecular weight: 59.13 kDa

pI: 4.37

Protein length: 536 aa

Gene length: 1611 bp

function: movement and chemotaxis

product: flagellar basal-body M-ring protein

essential: no

synonyms: fliF

List of homologs in different organisms, belongs to COG1766 (Galperin et al., 2021)

Gene

Coordinates: 1,692,496 → 1,694,106

Phenotypes of a mutant

• mucoid phenotype due to the overproduction of poly-gamma-glutamate [Pubmed|24296669]
• no secretion of [protein|F03144BF8A187C8931938A21433431B8961E8EE7|flgM], permanent inhibition of [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD] [Pubmed|25313396]
• inactivation of ''[gene|EB815705133E3318F655F6024B7D9BA587FD1DDA|fliF]'' confers resistance to high concentrations of Zn(II) [Pubmed|27935957]
• not essential for pellicle biofilm formation, but mutant is outcompeted by the wild-type strain when competed during pellicle formation [Pubmed|26122431]
• defective in [category|SW.4.1.4|Swarming] motility [pubmed|35638827]

Advertisement

The protein

Catalyzed reaction/ biological activity

• required for correct localization of [protein|1D51AF3E6456F126203D7C7273FB828A47E26DFB|fliM] [Pubmed|23190039]

Protein family

• FliF family (single member, according to UniProt)

Structure

• [PDB|6SCN] (from Salmonella typhimurium, corresponds to aa 16 ... 375, 27% identity)
• [AF|P23447]

[wiki|Localization]

• cell membrane [Pubmed|18763711]

Biological materials

Mutant

• DS7080 (marker-less  in NCIB3610) [Pubmed|24296669]
• BKE16210 (Δ[gene|EB815705133E3318F655F6024B7D9BA587FD1DDA|fliF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE16210 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTAACCCCCGGTCATT,  downstream forward: _UP4_GCCGAGGATTAGGAGGAATT
• BKK16210 (Δ[gene|EB815705133E3318F655F6024B7D9BA587FD1DDA|fliF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK16210 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTAACCCCCGGTCATT,  downstream forward: _UP4_GCCGAGGATTAGGAGGAATT

References

Reviews

• 26490009

Original Publications

• 36815589,26122431,1905667,17850253,14651647,18763711,9657996,8157612,15175317,23190039,24296669,25313396,24386445,25843804,27935957,30201778,37675594,35638827