cwlT

168

cell wall hydrolase, required for conjugation of ICEBs1, part of the type IV secretion system for DNA transfer , C-terminal domain hydrolyzes bond between D-Glu and m-DAP

locus: BSU_04970

Molecular weight: 36.39 kDa

pI: 8.63

Protein length: 329 aa

Gene length: 990 bp

function: conjugative transfer of ICEBs1

product: cell wall hydrolase

synonyms: cwlT, yddH

List of homologs in different organisms, belongs to COG0791 (Galperin et al., 2021)

Gene

Coordinates: 544,022  545,011

Advertisement

The protein

Catalyzed reaction/ biological activity

• hydrolysis of peptidoglycan (linkage between N-acetylmuramic acid and N-acetylglucosamine and bond between D--glutamate and  meso-diaminopimelic acid) [Pubmed|18305117]
• degradation of gamma-polyglutamic acid [pubmed|29458655]

Protein family

• [wiki|Peptidase C40 family] (according to UniProt)

[wiki|Domains]

• N-terminal domain is an N-acetylmuramidase that cleaves the linkage between N-acetylmuramic acid and N-acetylglucosamine [Pubmed|18305117]
• C-terminal D,L-endopeptidase domain ([wiki|NlpC/P60 domain]) [pubmed|29458655,22139507], cleaves the bond between D--glutamate and  meso-diaminopimelic acid [Pubmed|18305117]

Structure

• [PDB|4FDY] (from Staphylococcus aureus, 42% identity) [pubmed|24051416]
• [AF|P96645]

Effectors of protein activity

• both enzymatic activities are inhibited by interaction with [protein|0CA55371306D4BD768CFA82027DCB4D581BCCB87|iseA] [pubmed|29458655]

[wiki|Localization]

• secreted (with signal peptide) [Pubmed|24532767]
• may be a lipoprotein, but the lipid anchor is not required for function [Pubmed|24532767]

Biological materials

Mutant

• BKE04970 ([gene|8D9D81E05BAA8697F002BB1B8DBC5ABBA557353F|cwlT]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TATCATCTTGTTCTTTCATC,  downstream forward: _UP4_ATTAAATAACTAGGAGTGAA
• BKK04970 ([gene|8D9D81E05BAA8697F002BB1B8DBC5ABBA557353F|cwlT]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TATCATCTTGTTCTTTCATC,  downstream forward: _UP4_ATTAAATAACTAGGAGTGAA

References

• 18305117,24532767,24051416,29458655,32419322