ctpB

168

carboxy-terminal processing serine protease, cleaves [protein|AB2A3422277040107AAF90358BBE58608F8E0738|spoIVFA], this results in processing of pro-[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]

locus: BSU_35240

Molecular weight: 52.63 kDa

pI: 8.64

Protein length: 480 aa

Gene length: 1443 bp

function: control of [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK] activation

product: carboxy-terminal processing serine protease, cleaves [protein|AB2A3422277040107AAF90358BBE58608F8E0738|spoIVFA]

essential: no

synonyms: ctpB, yvjB

List of homologs in different organisms, belongs to COG0793 (Galperin et al., 2021)

Gene

Coordinates: 3,622,356  3,623,798

Advertisement

The protein

Catalyzed reaction/ biological activity

• The enzyme shows specific recognition of a C-terminal tripeptide, Xaa-Yaa-Zaa, in which Xaa is preferably Ala or Leu, Yaa is preferably Ala or Tyr, and Zaa is preferably Ala, but then cleaves at a variable distance from the C-terminus. A typical cleavage is -Ala-Ala-|-Arg-Ala-Ala-Lys-Glu-Asn-Tyr-Ala-Leu-Ala-Ala (according to UniProt)

Protein family

• Peptidase s41a family (together with [protein|5ED8301B9681FDD5171A9344A971E891493A6558|ctpA], according to Uniprot)
• PDZ protease [Pubmed|24243021]

[wiki|Domains]

• signal peptide (aa 1 - 23) (according to Uniprot)
• [wiki|PDZ domain] (aa 92 - 182) (according to Uniprot)
• S41 peptidase domain (by similarity to [protein|5ED8301B9681FDD5171A9344A971E891493A6558|ctpA]) [pubmed|29979679]
• peptidoglycan binding domain (C-terminal) (by similarity to [protein|5ED8301B9681FDD5171A9344A971E891493A6558|ctpA]) [pubmed|29979679]

Structure

• [PDB|4C2C] [Pubmed|24243021]
• forms a ring-like scaffold with two narrow tunnels for substrate binding [Pubmed|24243021]
• [AF|O35002]

Effectors of protein activity

• substrate binding of CtpB induces opening of the PDZ gate and protease activation [Pubmed|24243021]
• [protein|85247AD09B7A472607B32D57E6318BA6C83EC6BA|ctpB] acts in concert with a second signaling protease, [protein|DBB3ED60A7D162B9F2830F81041BC661AA5EC1E7|spoIVB] [Pubmed|24243021]

Paralogous protein(s)

• [protein|5ED8301B9681FDD5171A9344A971E891493A6558|ctpA]

[wiki|Localization]

• intracellular space between the mother cell and the forespore [Pubmed|24243021]

Biological materials

Mutant

• MGNA-A074 (yvjB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/74 NBRP B. subtilis, Japan]
• 1S129 ( ''ctpB''::''tet''), [Pubmed|14526016], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S129&Search=1S129 BGSC]
• BKE35240 ([gene|85247AD09B7A472607B32D57E6318BA6C83EC6BA|ctpB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE35240 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCTTTACTCCTCCTGTA,  downstream forward: _UP4_TAAAGGAGATGGTATTTCAT
• BKK35240 ([gene|85247AD09B7A472607B32D57E6318BA6C83EC6BA|ctpB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK35240 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCTTTACTCCTCCTGTA,  downstream forward: _UP4_TAAAGGAGATGGTATTTCAT

References

Reviews

• 31350897,33538382,34410368,35638784

Original Publications

• 14526016,17557826,16818230,15699190,16497325,24243021