crh

168

Carbon-flux regulating HPr, formerly known as Catabolite repression HPr-like protein, control of flux through the harmful methylglyoxal pathway, minor cofactor of the [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA] transcription factor

locus: BSU_34740

Molecular weight: 9.19 kDa

pI: 4.7

Protein length: 85 aa

Gene length: 258 bp

function: control of carbon flux

product: carbon-flux regulating HPr

essential: no

synonyms: crh, yvcM

List of homologs in different organisms, belongs to COG1925 (Galperin et al., 2021)

Gene

Coordinates: 3,569,292  3,569,549

Advertisement

The protein

Protein family

• HPr family (with [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH], according to UniProt)

[wiki|Domains]

• Hpr domain (aa 1-85) (according to UniProt)

Structure

• [PDB|2AK7] (dimeric Crh-Ser46-P) [pubmed|16411239]
• [PDB|1ZVV] ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]-Crh-DNA complex)
• [PDB|2RLZ] (dimer)
• [PDB|1MU4]
• [AF|O06976]

Modification

• phosphorylation on Ser46 by [protein|771F205F818A755A661B8E1C95365A4F6AEB05C7|hprK] [Pubmed|9237995,21992469,22092971]

Paralogous protein(s)

• [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]

Additional information

• Crh does not possess the phosphorylation site used for [protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI] phosphotransfer (His-15 in [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]), it can only be phosphorylated on Ser-46

Biological materials

Mutant

• GP860 (Δ[gene|A269774F2FDC94F93BA5F1360FFFE754B50383AD|crh]::aphA3) [Pubmed|21992469], available in [wiki|Jörg Stülke]'s lab
• QB7097 (spc), available in [wiki|Jörg Stülke]'s lab
• BKE34740 (Δ[gene|A269774F2FDC94F93BA5F1360FFFE754B50383AD|crh]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE34740 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAGATCTCCCCTTTTCT,  downstream forward: _UP4_GCTTACGTTCAAGAAGAAGT
• BKK34740 (Δ[gene|A269774F2FDC94F93BA5F1360FFFE754B50383AD|crh]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK34740 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAGATCTCCCCTTTTCT,  downstream forward: _UP4_GCTTACGTTCAAGAAGAAGT

Expression vectors

• pGP641 (N-terminal Strep-tag, purification from ''B. subtilis'', for [wiki|SPINE], in [wiki|pGP380]), available in [wiki|Jörg Stülke]'s lab
• pGP734 (C-terminal Strep-tag, purification from ''B. subtilis'', for [wiki|SPINE], in [wiki|pGP382]), available in [wiki|Jörg Stülke]'s lab

two-hybrid system

• [gene|A269774F2FDC94F93BA5F1360FFFE754B50383AD|crh], crh(Ser46Asp), crh(Ser46Ala) B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab

lacZ fusion

• see [gene|0C40455EB53D25363FC3EB0E84502A76520F5F91|nahA]

labs

• [wiki|Anne Galinier], University of Marseille, France
• [wiki|Richard Brennan], Houston, Texas, USA [http://www.mdanderson.org/departments/biochem/display.cfm?id=556ef368-6c81-4043-b74f350d41dd06cb&method=displayfull&pn=a8427ebd-d0ff-11d4-80fd00508b603a14 Homepage]

References

• 12972249,9973552,9237995,16272399,15126459,10217795,17142398,16316990,12009882,10589728,12670692,11916384,11361076,11361074,18320329,18284240,16411239,21992469,22092971,29514981