cpgA

168

ribosome assembly GTPase, activity stimulated by ribosomes, may be involved in the maturation of the 30S subunit of the ribosome, detoxification of 4-phosphoerythronate

locus: BSU_15780

Molecular weight: 33.64 kDa

pI: 4.74

Protein length: 298 aa

Gene length: 897 bp

function: ribosome assembly, coordination of peptidoglycan deposition in the cell wall, metabolite proofreading

product: GTPase

essential: no

synonyms: cpgA, yloQ, rsgA

List of homologs in different organisms, belongs to COG1162 (Galperin et al., 2021)

Gene

Coordinates: 1,653,103  1,653,999

Phenotypes of a mutant

• the mutant tends to acquire suppressor mutations that result in improved growth [Pubmed|28189581]
• forms curly cells [Pubmed|22544754]
• poor growth [pubmed|28189581]
• non-transformable [pubmed|28189581]
• defective in 16S rRNA 3' processing by [protein|E0437C86E5F3707FF1DA13C8B98F73130DED8FB4|yqfG] [pubmed|31003868]
• severe growth inhibition upon addition of subinhibitory concentrations of mirubactin C [pubmed|36312962]

Advertisement

The protein

Catalyzed reaction/ biological activity

• dephosphorylation of 4-phosphoerythronate thus preventing inhibition of [protein|61B7C51EB7E74226890010B61D8E41C02189A453|gndA] [pubmed|30948730]

Protein family

• TRAFAC class YlqF/YawG GTPase family (together with [protein|54CD247926F7FABE4ACE85EB7021B62500B47260|rbgA] and [protein|959C0ED7B9DA50F0EADCF1565405B878D36DA206|yqeH], according to UniProt)

[wiki|Domains]

• CP-type G domain (aa 67-228) (according to UniProt)

Structure

• [PDB|1T9H] [pubmed|15223319]
• [AF|O34530]

Modification

• ''in vitro'' phosphorylated on Thr-166 by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|prkC], dephosphorylated by [protein|84447F9A6644EA8A7593BB99B2B69D4377E670E2|prpC] [Pubmed|22544754,19246764]

Biological materials

Mutant

• MGNA-B135 (yloQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1134 NBRP B. subtilis, Japan]
• BKE15780 ([gene|519D4694B2895EE6F0D38D918F52F27734506848|cpgA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE15780 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTCAGGCATATTTTCCCTCC,  downstream forward: _UP4_GACAGAAAGCCGAGGTATTA
• BKK15780 ([gene|519D4694B2895EE6F0D38D918F52F27734506848|cpgA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK15780 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTCAGGCATATTTTCCCTCC,  downstream forward: _UP4_GACAGAAAGCCGAGGTATTA
• BP1272 ([gene|519D4694B2895EE6F0D38D918F52F27734506848|cpgA]::cat trp+) available in [wiki|Jörg Stülke]'s & [wiki|Fabian Commichau]'s lab, strain cannot grow with glucose, see Sachla et al (2019)

labs

• [wiki|Tony Wilkinson], York University, U.K. [http://www.york.ac.uk/depts/chem/staff/ajw.html homepage]

References

Reviews

• 19575570

Original Publications

• 15223319,16485133,14747714,22544754,18344364,19246764,19246764,15828870,17005971,18344364,18984160,28189581,30948730,31003868,36312962,36840557