citG

168

fumarase

locus: BSU_33040

Molecular weight: 50.36 kDa

pI: 5.47

Protein length: 462 aa

Gene length: 1389 bp

function: TCA cycle

product: fumarate hydratase

essential: no

ec: 4.2.1.2

synonyms: citG, fumC

List of homologs in different organisms, belongs to COG0114 (Galperin et al., 2021)

Gene

Coordinates: 3,389,024 3,390,412

Phenotypes of a mutant

• arginine is toxic for the mutant, this can be bypassed by inactivation of [gene|9BFB16C12B31ABD70BBB921BCB9E4201E3BDC92D|rocC] encoding the major arginine transporter [pubmed|38483038]

Advertisement

The protein

Catalyzed reaction/ biological activity

• (S)-malate --> fumarate + H₂O (according to UniProt)

Protein family

• class-II fumarase/aspartase family (with [protein|5FAE80F22AEBAE63FC3C872EC651166A65C34DC2|ansB], according to UniProt)

Structure

• [PDB|1FUO] (from ''E. coli'', 64% identity) [Pubmed|8909293]
• [AF|P07343]

Paralogous protein(s)

• [protein|5FAE80F22AEBAE63FC3C872EC651166A65C34DC2|ansB]

[wiki|Localization]

• forms discrete foci in the cytoplasm [pubmed|29140245]
• colocalizes with DNA upon DNA damage (MMS treatment) [pubmed|29140245]

Additional information

• belongs to the 100 most abundant proteins [PubMed|15378759]

Biological materials

Mutant

• GP718 (spec), available in [wiki|Jrg Stlke]'s lab [pubmed|20933603]
• GP2340 ''[gene|A3A2EF3C95B833A11843553107D781EDEFF0BC41|citG]''::''kan'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [wiki|Jrg Stlke]'s lab
• GP2341 ''[gene|A3A2EF3C95B833A11843553107D781EDEFF0BC41|citG]''::''lox72'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [wiki|Jrg Stlke]'s lab
• BKE33040 ([gene|A3A2EF3C95B833A11843553107D781EDEFF0BC41|citG]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE33040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATGTATCCCTCCATA, downstream forward: _UP4_TAATAGGAAGAACGGCTGCT
• BKK33040 ([gene|A3A2EF3C95B833A11843553107D781EDEFF0BC41|citG]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK33040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATGTATCCCTCCATA, downstream forward: _UP4_TAATAGGAAGAACGGCTGCT

Expression vectors

• pGP1122 (N-terminal Strep-tag, for [wiki|SPINE], purification from ''B. subtilis'', in [wiki|pGP380]) (available in [wiki|Jrg Stlke]'s lab) [pubmed|20933603]
• pGP3706: IPTG inducible expression, purification in ''E. coli'' with N-terminal Strep-tag, in [wiki|pGP172], available in [wiki|Jörg Stülke]'s lab

two-hybrid system

• ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jrg Stlke]'s lab

FLAG-tag construct

• GP1132 (spc, based on [wiki|pGP1331]), available in [wiki|Jrg Stlke]'s lab

lacZ fusion

• pGP387 (in [wiki|pAC7]), available in [wiki|Jrg Stlke]'s lab

Antibody

• **

GFP fusion

• GP1433 (spc, based on [wiki|pGP1870]), available in the [wiki|Jrg Stlke] lab

References

• 2509422,3923430,3130545,2509423,20933603,15378759,6098632,8909293,29140245,38483038