cheA

168

two-component sensor kinase, chemotactic signal modulator

locus: BSU_16430

Molecular weight: 74.59 kDa

pI: 4.45

Protein length: 672 aa

Gene length: 2019 bp

function: chemotactic signal modulator

product: two-component sensor kinase

essential: no

synonyms: cheA, cheN

List of homologs in different organisms, belongs to COG0643 (Galperin et al., 2021)

Gene

Coordinates: 1,712,815  1,714,833

Phenotypes of a mutant

• not essential for pellicle biofilm formation, but mutant is outcompeted by the wild-type strain when competed during pellicle formation [Pubmed|26122431]
• defective in [category|SW.4.1.4|Swarming] motility [pubmed|35638827]

Advertisement

The protein

Catalyzed reaction/ biological activity

• autophosphorylation, phosphorylation of [protein|2F0495C7EAB81BDB1F3181677C555537BD2A972F|cheY] and [protein|B0415A8CD040EC714B54F4038E065B3E1E20A271|cheB] [Pubmed|11553614]
• ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)

[wiki|Domains]

• HPt domain (aa 1-103) (according to UniProt)
• P2/ CheY-binding domain
• dimerization domain
• [wiki|Histidine kinase domain] (aa 290-540) (according to UniProt)
• CheW-like domain (aa 542-672) (according to UniProt)

Structure

• [PDB|6S1K] (from E. coli, 35% identity) [pubmed|31925330]
• [AF|P29072]

Modification

• autophosphorylation on a His residue

Effectors of protein activity

• phosphorylation of [protein|6B3B222E56BF0C95A2371CA5208B5522B44D4689|cheA] is stimulated by interaction with the complex of deaminated [protein|8333CD46F704F03A22482CAA98DEFCC945362A10|mcpC]-[protein|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|cheD] [Pubmed|22931217]
• the kinase activity of [protein|6B3B222E56BF0C95A2371CA5208B5522B44D4689|cheA] is activated by chemoreceptors bound to [protein|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|cheD] [Pubmed|23226535]

[wiki|Localization]

• membrane (according to UniProt)
• localizes to the cell poles [Pubmed|21098025]

Expression and Regulation

additional information

• in minimal medium, CheA is present with 2,600 +/- 560 molecules per cell [PubMed|21515776]

Biological materials

Mutant

• 1A797 ( ''cheA''::''cat''), [Pubmed|1938941], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A797&Search=1A797 BGSC]
• DS6887 (marker-less in NCIB3610) [Pubmed|25313396]
• BKE16430 ([gene|6B3B222E56BF0C95A2371CA5208B5522B44D4689|cheA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE16430 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATACTGATTCATATCCATTT,  downstream forward: _UP4_TAACCATTCGAGGAGGTGTC
• BKK16430 ([gene|6B3B222E56BF0C95A2371CA5208B5522B44D4689|cheA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK16430 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATACTGATTCATATCCATTT,  downstream forward: _UP4_TAACCATTCGAGGAGGTGTC

labs

• [wiki|Daniel Kearns]

References

Reviews

• 20122866,38038435

Original Publications

• 26122431,25313396,1938941,12123464,17908686,8866475,12094812,10094672,11722727,14651647,9657996,8157612,15175317,9721285,17850253,11553614,21098025,22931217,21515776,23226535,24386445,25039821,31925330,35638827,37790397