cggR

168

repressor of the glycolytic [gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA] operon, [wiki|DeoR family]

locus: BSU_33950

Molecular weight: 37.23 kDa

pI: 5.68

Protein length: 340 aa

Gene length: 1023 bp

function: transcriptional regulator

product: central glycolytic genes regulator

essential: no

synonyms: cggR, yvbQ

List of homologs in different organisms, belongs to COG2390 (Galperin et al., 2021)

Gene

Coordinates: 3,482,752  3,483,774

Phenotypes of a mutant

• suppresses the growth defect of [gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR] mutants on gluconeogenic substrates [Pubmed|16272399]

Advertisement

The protein

Catalyzed reaction/ biological activity

• transcription repression of the glycolytic ''[gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA]'' operon

Protein family

• SorC transcriptional regulatory family (with [protein|E9C4C569F18B3335DA9C7FB5B17C87D661E62669|deoR], according to UniProt)

[wiki|Domains]

• DNA binding domain (H-T-H motif) (3756)

Structure

• [PDB|3BXH] (in complex with fructose-6-phosphate) [pubmed|18554327]
• [PDB|2OKG] (effector binding domain) [pubmed|18554327]
• [PDB|7OYK] (complex of the DNA-binding domain with the operator DNA) [pubmed|34726169]
• [AF|O32253]

Effectors of protein activity

• fructose 1.6-bisphosphate [Pubmed|29923648,12622823] and dihydroxyacetone phosphate, glucose-6-phosphate and fructose-6-phosphate [Pubmed|18554327] act as inducer and result in release of [protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR] from the DNA

[wiki|Localization]

• cytoplasma [Pubmed|20572937]

Expression and Regulation

additional information

• the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]

Biological materials

Mutant

• MGNA-A463 (yvbQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/463 NBRP B. subtilis, Japan]
• GP311 (in frame deletion), available in [wiki|Jörg Stülke]'s lab
• SM-NB7 (cggR-spc), available in [wiki|Anne Galinier]'s and [wiki|Boris Görke]'s labs
• BKE33950 ([gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE33950 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACTCAAACGTTCCTTC,  downstream forward: _UP4_TAATCCCTCAATATAAATAT
• BKK33950 ([gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK33950 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACTCAAACGTTCCTTC,  downstream forward: _UP4_TAATCCCTCAATATAAATAT

Expression vectors

• pGP705 (N-terminal His-tag, in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab

lacZ fusion

• pGP504 (in [wiki|pAC7]), pGP509 (in [wiki|pAC6]), available in [wiki|Jörg Stülke]'s lab

Antibody

• available in [wiki|Jörg Stülke]'s lab

labs

• [wiki|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France

References

Reviews

• 20408793

Original Publications

• 20462860,22190493,23280112,21815947,19193632,12850135,12622823,18186488,10799476,11489127,12123463,12634343,18052209,17293407,20361740,20444087,18554327,25099370,26883633,16272399,29923648,30082753,34726169