lonA

168

class III heat-shock ATP-dependent protease

locus: BSU_28200

Molecular weight: 86.42 kDa

pI: 5.77

Protein length: 774 aa

Gene length: 2325 bp

function: protein quality control, control of swarming motility

product: class III heat-shock ATP-dependent protease

essential: no

synonyms: lonA, lon

List of homologs in different organisms, belongs to COG0466 (Galperin et al., 2021)

Gene

Coordinates: 2,880,466 → 2,882,790

Phenotypes of a mutant

• presence of predifferentiated swarmer cells in liquid medium [Pubmed|25538299]

Advertisement

The protein

Catalyzed reaction/ biological activity

• Hydrolysis of proteins in presence of ATP (according to UniProt)
• inhibits swarming motility by preventing accumulation of SwrA in liquid medium [Pubmed|25538299]

Protein family

• Peptidase S16 family (with [protein|1A5C1BDE844AA56B90C0E4A02D74978676487E99|ddcP] and [protein|CA90AAE5320C20F93F5ED0F167294C28495756FF|lonB], according to UniProt)

[wiki|Domains]

• Lon N-terminal (aa 9-200) (according to UniProt)
• Lon proteolytic (aa 590-771) (according to UniProt)

Structure

• [PDB|6U5Z] (from E. coli, 56% identity)
• [PDB|5E7S] (active hexamer from ''Meiothermus taiwanensis'', 63% identity, 89% similarity) [Pubmed|27041593]
• [PDB|4YPN] (ADP-bound hexamer from ''Meiothermus taiwanensis'', 63% identity, 89% similarity) [Pubmed|27041592]
• [PDB|3M65] (N-terminal domain) [Pubmed|20600124]
• [PDB|3M6A] (C-terminal domain) [Pubmed|20600124]
• [PDB|1X37] (Ssd domain)
• [AF|P37945]

[wiki|Localization]

• coincident with the nucleoid during normal growth and localized to the forespore during development [Pubmed|18689473]

Expression and Regulation

Operons

• genes: [gene|FF15BE26BCC78EC1301C58A51AF0A519D7BE9ADC|lonA]-[gene|DF1A043F3D9817D9479B8C707F4ACEEF2BF2862C|ysxC]

  description: [Pubmed|7961402]

  regulation

  • induced by heat stress ([protein|search|CtsR]) [Pubmed|9852015]

  regulatory mechanism

  • [protein|908DB17A39D518E84977250C55825E77FA02E391|ctsR]: repression, [Pubmed|9852015], in [regulon|protein:908DB17A39D518E84977250C55825E77FA02E391|ctsR regulon]

  sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7961402], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]

Biological materials

Mutant

• BKE28200 (Δ[gene|FF15BE26BCC78EC1301C58A51AF0A519D7BE9ADC|lonA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE28200 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGACTGACACCTCCGT,  downstream forward: _UP4_AAATGAAAGTCACAAAGTCA
• BKK28200 (Δ[gene|FF15BE26BCC78EC1301C58A51AF0A519D7BE9ADC|lonA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK28200 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGACTGACACCTCCGT,  downstream forward: _UP4_AAATGAAAGTCACAAAGTCA

References

Reviews

• 23479438,26639779,34410368

Original Publications

• 7961403,7961402,19542270,19643080,9852015,18689473,20600124,25538299,27041592,27041593,29311275,34757797,35595098