recD2

168

5'-3' DNA helicase replication fork progression, crucial for the [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA]-dependent acquisition of homologous genes from related species by natural transformation

locus: BSU_27480

Molecular weight: 88.99 kDa

pI: 5.08

Protein length: 798 aa

Gene length: 2397 bp

function: replication fork progression, control of [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA] activity

product: 5'-3' DNA helicase

essential: no

ec: 3.6.4.12

synonyms: recD2, yrrC

List of homologs in different organisms, belongs to COG0507 (Galperin et al., 2021)

Gene

Coordinates: 2,806,286  2,808,682

Phenotypes of a mutant

• modest increase in spontaneous mutation rate [Pubmed|24443534]
• [gene|A3D05FE662CCCFE79B3CB38486206413B84E5D80|recD2] [gene|24B1C2A663A5B7C45940272595868F9F05A04A7B|recG] as well as [gene|A3D05FE662CCCFE79B3CB38486206413B84E5D80|recD2] [gene|7EBC90946E7167A3B0212193873855CAE0EFF7D4|ruvA]-[gene|search|ruvB ]combined mutants are not viable [pubmed|28527403]

Advertisement

The protein

Catalyzed reaction/ biological activity

• ATP + H₂O --> ADP + H⁺ + phosphate (according to UniProt)
• [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA] polymerized on tailed SPP1 duplex intermediates invades a homologous region in another incomplete molecule, and in concert with [protein|A3D05FE662CCCFE79B3CB38486206413B84E5D80|recD2] helicase, reconstitutes a complete linear phage genome with redundant regions at the ends of the molecule [pubmed|31876108]

Protein family

• RecD family (single member, according to UniProt)

Structure

• [PDB|3E1S] (from Deinococcus radiodurans, 28% identity, from aa 178 - 767) [pubmed|18668125]
• [AF|O34481]

Expression and Regulation

Operons

• genes: [gene|50930C56C27D22715620A350220E3C56ADB41020|cymR]-[gene|4F5945C3C8F18BD1B30D97CD516A06077C200B9D|yrvO]-[gene|2F5DFBE980FFF5810B76BCFCD189BA0F6C415B4F|trmU]-[gene|07DFF7D7BE1BACFB148F600400BDE5933BF1DD07|yrrB]-[gene|A3D05FE662CCCFE79B3CB38486206413B84E5D80|recD2]

  description: [Pubmed|22383849]

additional information

• protein has a low abundance (about 25 monomers per cell) [pubmed|35234892]

Biological materials

Mutant

• MGNA-A858 (yrrC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/858 NBRP B. subtilis, Japan]
• BKE27480 ([gene|A3D05FE662CCCFE79B3CB38486206413B84E5D80|recD2]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE27480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGAGCTGTCCCTCCTCCT,  downstream forward: _UP4_TAAAATGCTCCCGTGCAAGC
• BKK27480 ([gene|A3D05FE662CCCFE79B3CB38486206413B84E5D80|recD2]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK27480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGAGCTGTCCCTCCTCCT,  downstream forward: _UP4_TAAAATGCTCCCGTGCAAGC

References

• 21170359,24443534,28527403,18668125,31876108,33264457,35234892,38052445