cdaA

168

diadenylate cyclase, synthesis of c-di-AMP in vegetative cells

locus: BSU_01750

Molecular weight: 30.42 kDa

pI: 8.07

Protein length: 273 aa

Gene length: 822 bp

function: synthesis of c-di-AMP

product: diadenylate cyclase

essential: no

ec: 2.7.7.85

synonyms: cdaA, ybbP, ybbQ

List of homologs in different organisms, belongs to COG1624 (Galperin et al., 2021)

Gene

Coordinates: 196,213 → 197,034

Phenotypes of a mutant

• inactivation of ''[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]'' results in severe beta-lactam sensitivity [Pubmed|22211522]
• a [gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA] [gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA] double mutant or [gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA] [gene|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS] [gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA] triple mutant is not viable on complex medium; however, the mutant grows at low potassium concentration (0.1 mM) [pubmed|28420751]
• increased spontaneous mutagenesis [pubmed|36613897]

Advertisement

The protein

Catalyzed reaction/ biological activity

• synthesis of c-di-AMP from two molecules of ATP [Pubmed|23192352]
• 2 ATP --> c-di-AMP + 2 diphosphate (according to UniProt)

Protein family

• adenylate cyclase family (with [protein|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS], according to UniProt)

[wiki|Domains]

• contains a [wiki|DAC domain] involved in the synthesis of c-di-AMP [Pubmed|21566650]
• [wiki|DAC domain] (aa 82-242) (according to UniProt)

[wiki|Cofactors]

• Mn²⁺ [pubmed|31118276,25605729]

Structure

• [PDB|6HUW] (the [wiki|DAC domain])
• [PDB|7OLH], [PDB|7OJS] (complex of the [protein|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA] [wiki|DAC domain] and [protein|F022ACB2CBB8DA46B392CE1D26474093645F26DA|glmM])
• [PDB|4RV7] (the [wiki|DAC domain] and C-terminal domain of CdaA from ''Listeria monocytogenes'' (aa 101 - 273), 65% identity) [Pubmed|25605729]
• [PDB|6HVL] (the [wiki|DAC domain] and C-terminal domain of CdaA from ''Listeria monocytogenes'' (aa 101 - 273) in complex with c-di-AMP, 65% identity) [Pubmed|31118276]
• [AF|Q45589]

Effectors of protein activity

• the interaction with [protein|FB23F2AB0E2A82658009D115E5876E7AF1BDE5FD|cdaR] controls the diadenylate cyclase activity of [protein|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA] [Pubmed|23192352]
• the interaction with [protein|FB23F2AB0E2A82658009D115E5876E7AF1BDE5FD|cdaR] inhibits the diadenylate cyclase activity of [protein|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA] (shown in S. aureus) [pubmed|30668586]
• the interaction with [protein|F022ACB2CBB8DA46B392CE1D26474093645F26DA|glmM] inhibits the diadenylate cyclase activity of [protein|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA] ([pubmed|34678313]) under conditions of osmotic stress (shown in L. monocytogenes) [pubmed|32250026]

Paralogous protein(s)

• [protein|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS]

[wiki|Localization]

• cell membrane [Pubmed|26240071]

Expression and Regulation

Operons

• genes: [gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]-[gene|FB23F2AB0E2A82658009D115E5876E7AF1BDE5FD|cdaR]-[gene|F022ACB2CBB8DA46B392CE1D26474093645F26DA|glmM]-[gene|4E23D2043D51C587027ABBF6335F148295E90B8F|glmS]

  description: [Pubmed|23192352]

  regulatory mechanism

  • GlmS ribozyme: RNA switch, in [regulon|other_regulator:GlmS ribozyme|GlmS ribozyme]

  sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|22211522], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]

additional information

• CdaA levels are increased at increased potassium concentrations [pubmed|28420751]
• the mRNA is very stable (> 15 min) [pubmed|12884008]

Biological materials

Mutant

• GP94 Δ[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]::spec, available in [wiki|Jörg Stülke]'s lab [pubmed|28420751]
• GP997 Δ[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]::cat, available in [wiki|Jörg Stülke]'s lab [pubmed|23192352]
• GP2790 Δ[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]::aphA3, available in [wiki|Jörg Stülke]'s lab
• GP985 Δ[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]-[gene|FB23F2AB0E2A82658009D115E5876E7AF1BDE5FD|cdaR]::''cat'', available in [wiki|Jörg Stülke]'s lab [pubmed|23192352]
• GP2222 [gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]::cat [gene|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS]::ermC ''[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]''::''tet'', available in [wiki|Jörg Stülke]'s lab, the mutant is only viable on minimal medium at low potassium concentration [pubmed|28420751]
• BKE01750 (Δ[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE01750 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTCGTCCTCCAAGA,  downstream forward: _UP4_CGCTGGTATTGGAGGGGCAA
• BKK01750 (Δ[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK01750 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTCGTCCTCCAAGA,  downstream forward: _UP4_CGCTGGTATTGGAGGGGCAA

Expression vectors

• expression of native ''cdaA'' in ''B. subtilis'': pGP1960 (in [wiki|pBQ200]), available in [wiki|Jörg Stülke]'s lab
• expression of ''cdaA''-Strep in ''B. subtilis'' suitable for [wiki|SPINE]: pGP1986 (in [wiki|pGP382]), available in [wiki|Jörg Stülke]'s lab
• IPTG inducible expression of ''cdaA''-Strep in ''E. coli'': pGP2564 (in [wiki|pGP574]), available in [wiki|Jörg Stülke]'s lab
• IPTG inducible expression of His-''cdaA'' in ''E. coli'': pGP1970 (in pET19B), available in [wiki|Jörg Stülke]'s lab [pubmed|23192352]

two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab. Respective plasmid: pGP1990 [pubmed|23192352]

FLAG-tag construct

• GP1381 ''cdaA-3xFLAG ermC'' (based on [wiki|pGP1087]), available in [wiki|Jörg Stülke]'s lab [pubmed|28420751]

lacZ fusion

• GP1339 (cat) based on [wiki|pAC6], available in [wiki|Jörg Stülke]'s lab [pubmed|23192352]

labs

• [wiki|Jörg Stülke], University of Göttingen, Germany [http://genmibio.uni-goettingen.de Homepage]

References

Reviews

• 18714086,25869574,23812326,30224435,32472931,32603625,37022175,37954098,38551349

Original Publications

• 32250026,12884008,21566650,23192352,22211522,25605729,25616256,26240071,26527648,26585449,28420751,30668586,31118276,34678313,36613897