addB

168

ATP-dependent deoxyribonuclease (subunit B), required for efficient survival and replication restart after replication-transcription conflicts, responsible for end resection during dsDNA break repair

locus: BSU_10620

Molecular weight: 134.41 kDa

pI: 5.39

Protein length: 1166 aa

Gene length: 3501 bp

function: DNA repair/ recombination

product: ATP-dependent deoxyribonuclease (subunit B))

essential: no

synonyms: addB

List of homologs in different organisms, belongs to COG3857 (Galperin et al., 2021)

Gene

Coordinates: 1,136,320  1,139,820

Phenotypes of a mutant

• reduced survival after mitomycin treatment [pubmed|34339298]
• ''[gene|80E6F156764FF30300D034EE6FB44F2DB8338AF3|recO] [gene|49E8BFEC1CAB77DD91E0ED0791EBD480E4871239|addA]-[gene|55A1EF8A10CB398CCD3FDD06D9483FE0DCE31C64|addB]'' double mutants are extremely sensitive against DNA damaging agents [Pubmed|26001966]

Advertisement

The protein

Catalyzed reaction/ biological activity

• the enzyme is functional as a heterodimer of the [protein|49E8BFEC1CAB77DD91E0ED0791EBD480E4871239|addA] and [protein|55A1EF8A10CB398CCD3FDD06D9483FE0DCE31C64|addB] subunits, that it is a rapid and processive DNA helicase, and that it catalyses DNA unwinding using one single-stranded DNA motor of 3'5' polarity located in the [protein|49E8BFEC1CAB77DD91E0ED0791EBD480E4871239|addA] subunit [Pubmed|21071401]
• the [protein|55A1EF8A10CB398CCD3FDD06D9483FE0DCE31C64|addB] subunit contains a second putative ATP-binding pocket, but this does not contribute to the observed helicase activity and may instead be involved in the recognition of recombination hotspot sequences [Pubmed|21071401]
• ATP + H₂O --> ADP + H⁺ + phosphate (according to UniProt)

Protein family

• [wiki|helicase family] (according to UniProt)

[wiki|Domains]

• [wiki|UvrD-like helicase ATP-binding domain](aa 1-278) (according to UniProt)
• [wiki|UvrD-like helicase C-terminal domain] (aa 281-586) (according to UniProt)

[wiki|Cofactors]

• Fe-S cluster [pubmed|29292548]

Structure

• [PDB|3U4Q] (the [protein|49E8BFEC1CAB77DD91E0ED0791EBD480E4871239|addA]-[protein|55A1EF8A10CB398CCD3FDD06D9483FE0DCE31C64|addB]-DNA complex) [Pubmed|22307084]
• [AF|P23477]

Biological materials

Mutant

• GP1106 ([gene|49E8BFEC1CAB77DD91E0ED0791EBD480E4871239|addA]-[gene|55A1EF8A10CB398CCD3FDD06D9483FE0DCE31C64|addB], spc), available in [wiki|Jörg Stülke]'s lab [pubmed|22178973]
• BKE10620 ([gene|55A1EF8A10CB398CCD3FDD06D9483FE0DCE31C64|addB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE10620 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATTAGAAGACCCCTCTC,  downstream forward: _UP4_TGGATAAAAAAGGAGGCGGA
• BKK10620 ([gene|55A1EF8A10CB398CCD3FDD06D9483FE0DCE31C64|addB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK10620 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATTAGAAGACCCCTCTC,  downstream forward: _UP4_TGGATAAAAAAGGAGGCGGA

labs

• [wiki|Mark Dillingham], Bristol, U.K. ([http://www.bris.ac.uk/biochemistry/research/md.html homepage])

References

Reviews

• 23202527,20116346,22933559,19542287,25486468,32286623,36030574

Original Publications

• 21809208,8387145,15610857,7746142,19129187,1646786,10756102,9781875,17570399,20350930,22307084,22383849,21071401,23056615,24682829,24670664,8752329,25939832,26001966,8510642,33085588,34339298