pucM
168
uricase
locus
BSU_32460
Molecular weight
13.27 kDa
pI
5.08
function
purine utilization
product
uricase
essential
no
ec
3.5.2.17
synonyms
pucM, yunM
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG2351 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
3,334,646 3,334,990
The protein
Catalyzed reaction/ biological activity
5-hydroxyisourate + H2O --> 5-hydroxy-2-oxo-4-ureido-2,5-dihydro-1H-imidazole-5-carboxylate + H+ (according to UniProt)
Protein family
transthyretin family (according to UniProt)
Structure
[PDB|2H0E] [Pubmed|16782815]
[AF|O32142]
Expression and Regulation
Operons
genes
[gene|53950BFDC128DE46F3F43BDB9D0FDB3D645152DF|pucJ]-[gene|3162EF36F4441A1E4EBBFDAD19F6768D8EF21B29|pucK]-[gene|2E7DEC53A130247E66225E87950D702E462C324F|pucL]-[gene|A2F93FFE225DFDBCBB3EA079BEF84C79465F0E5C|pucM]
description
[Pubmed|12029039]
regulation
expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
regulatory mechanism
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: activation, [Pubmed|12823818], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|52C1601482C26400A524E880334BB801F832D6ED|pucR]: activation, [Pubmed|12029039], in [regulon|protein:52C1601482C26400A524E880334BB801F832D6ED|pucR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12029039], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
genes
[gene|52C1601482C26400A524E880334BB801F832D6ED|pucR]-[gene|53950BFDC128DE46F3F43BDB9D0FDB3D645152DF|pucJ]-[gene|3162EF36F4441A1E4EBBFDAD19F6768D8EF21B29|pucK]-[gene|2E7DEC53A130247E66225E87950D702E462C324F|pucL]-[gene|A2F93FFE225DFDBCBB3EA079BEF84C79465F0E5C|pucM]
description
[Pubmed|12823818]
regulation
expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
regulatory mechanism
[protein|52C1601482C26400A524E880334BB801F832D6ED|pucR]: auto-repression, [Pubmed|12029039], in [regulon|protein:52C1601482C26400A524E880334BB801F832D6ED|pucR regulon]
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: activation, [Pubmed|25755103], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
Biological materials
Mutant
MGNA-A938 (yunM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/938 NBRP B. subtilis, Japan]
BKE32460 ([gene|A2F93FFE225DFDBCBB3EA079BEF84C79465F0E5C|pucM]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE32460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATATGGGTTGTCAGTTTTC, downstream forward: _UP4_TAAGAAGGAAGCCCGCCTCA
BKK32460 ([gene|A2F93FFE225DFDBCBB3EA079BEF84C79465F0E5C|pucM]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK32460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATATGGGTTGTCAGTTTTC, downstream forward: _UP4_TAAGAAGGAAGCCCGCCTCA
References
Page visits: 6583
Time of last update: 2025-10-25 19:25:24
Author of last update: Melvin.boenninger