ldt
168
L,D-transpeptidase involved in cell wall synthesis
locus
BSU_14040
Molecular weight
17.59 kDa
pI
10.25
function
cell wall biosynthesis
product
L,D-transpeptidase
essential
no
synonyms
ldt, ykuD
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG1388 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
1,476,518 1,477,012
The protein
Protein family
YkuD family (with [protein|456AF184261976FAA73359E81443F7035F457D07|yciB] and [protein|293794B65B9EEB7F049138F73893303BABFB9A2A|yqjB], according to UniProt)
[wiki|Domains]
contains a N-terminal N-acetylglucosamine-polymer-binding [wiki|LysM domain] [Pubmed|18430080]
[wiki|LysM domain] (aa 2-45) (according to UniProt)
Structure
[PDB|1Y7M] [Pubmed|16287140]
[PDB|2MTZ] (complex with a peptidoglycan hexamuropeptide) [Pubmed|25429710]
[AF|O34816]
Paralogous protein(s)
[protein|293794B65B9EEB7F049138F73893303BABFB9A2A|yqjB]
[wiki|Localization]
spore wall (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|6F256986E591DB82974A7F54EB1CE0C024A6F63B|ldt]
description
[Pubmed|11011148]
regulation
expressed during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|11011148]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|12850135], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, [Pubmed|11011148], in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
genes
[gene|253A24EEA02C07E577A96FB64DF39F9A3D0C3A52|ykuE]-[gene|6F256986E591DB82974A7F54EB1CE0C024A6F63B|ldt]-[gene|DDAE68CD8D7F0D9C46E62D0EDBF4631C9EC4C236|ykuC]
description
[Pubmed|22383849]
regulation
expressed during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|11011148]
Biological materials
Mutant
MGNA-A766 (ykuD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/766 NBRP B. subtilis, Japan]
BKE14040 ([gene|6F256986E591DB82974A7F54EB1CE0C024A6F63B|ldt]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE14040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGTTTCCTCATCCTCCTTT, downstream forward: _UP4_TAATGTTTTCTTATTTGTTT
BKK14040 ([gene|6F256986E591DB82974A7F54EB1CE0C024A6F63B|ldt]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK14040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGTTTCCTCATCCTCCTTT, downstream forward: _UP4_TAATGTTTTCTTATTTGTTT
References
Reviews
Original Publications
Page visits: 4559
Time of last update: 2025-10-22 19:00:38
Author of last update: Jstuelk