lipA

lipA
168

lipoyl synthase, trigger enzyme

locus
BSU_32330
Molecular weight
33.77 kDa
pI
8.25
Protein length
Gene length
function
synthesis of lipoic acid
product
lipoyl synthase,trigger enzyme
essential
no
ec
2.8.1.8
synonyms
lipA, yutB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0320 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,320,324  3,321,220
Phenotypes of a mutant
reduced transformation efficiency [Pubmed|19028902]
strong inhibition of growth on minimal media [Pubmed|19820084]
The protein
Catalyzed reaction/ biological activity
[[Fe-S] cluster scaffold protein carrying a second [4Fe-4S]2+ cluster] + 4 H+ + N6-octanoyl-L-lysyl-[protein] + 2 oxidized [2Fe-2S]-[ferredoxin] + 2 S-adenosyl-L-methionine --> (R)-N6-dihydrolipoyl-L-lysyl-[protein] + 2 5'-deoxyadenosine + [[Fe-S] cluster scaffold protein] + 4 Fe3+ + 2 hydrogen sulfide + 2 L-methionine + 2 reduced [2Fe-2S]-[ferredoxin] (according to UniProt)
required for ''[gene|788725411B2E741103603373E43441FD036E1BA0|comEA]'' transcription  [Pubmed|19028902]
Protein family
[wiki|Radical SAM superfamily] (according to UniProt)
[wiki|Cofactors]
Fe-S cluster [pubmed|29292548]
Structure
[PDB|4U0O] (from ''Thermosynechococcus elongatus'', 48% identity) [Pubmed|25100160]
[AF|O32129]
Expression and Regulation
Operons
genes
[gene|2EC820F54911603A99444DC922E41C60AA526EB2|lipA]
description
[pubmed|22383849]
Open in new tab

[gene|2EC820F54911603A99444DC922E41C60AA526EB2|lipA]

2025-10-23 07:05:16

Jstuelk

111

523e182f6bede4be80fa8d706c9597b809f50efa

153A8527F00EC7EDAF9E4B7A28190EE522FB5172

Biological materials
Mutant
MGNA-B578 (yutB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1577 NBRP B. subtilis, Japan]
BKE32330 ([gene|2EC820F54911603A99444DC922E41C60AA526EB2|lipA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE32330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTCCCATCATCTCCAAT,  downstream forward: _UP4_TAATGCCAAAACGCCAGATC
BKK32330 ([gene|2EC820F54911603A99444DC922E41C60AA526EB2|lipA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK32330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTCCCATCATCTCCAAT,  downstream forward: _UP4_TAATGCCAAAACGCCAGATC
References
Reviews
27074917,38624243
Original Publications
18957862,19028902,19820084,25100160

2EC820F54911603A99444DC922E41C60AA526EB2

Page visits: 5520

Time of last update: 2025-10-25 04:51:16

Author of last update: Jstuelk