yhfE

yhfE
168

similar to aminopeptidase

locus
BSU_10200
Molecular weight
38.58 kDa
pI
5.88
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yhfE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1363 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,095,063 → 1,096,103
The protein
Protein family
Peptidase M42 family (with [protein|D6F5F7C1C699C674FA7AC09A020E8E2F571E1AA9|ysdC] and [protein|16585F4118F3D2732D6780D351B7AA5F6DDCCEB8|ytoP], according to UniProt)
Structure
[PDB|2GRE] (from ''Bacillus Cereus'', 71% identity)
[AF|O07603]
Expression and Regulation
Operons
genes
[gene|EDD5ACB89661D3B6D77057863EF345EBF84F49B2|yhfE]-[gene|A666F376947A675E04550338C3177FF8AFF44DF4|yhfF]
description
[Pubmed|22383849]
Open in new tab

[gene|EDD5ACB89661D3B6D77057863EF345EBF84F49B2|yhfE]→[gene|A666F376947A675E04550338C3177FF8AFF44DF4|yhfF]

2025-10-24 16:47:04

Jstuelk

123

fa79211a992b92a771ee8ba9fd427bbd106f3c46

0ADAC7AF117525E8C08E677259E2223C54C256E0

Biological materials
Mutant
MGNA-A710 (yhfE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/710 NBRP B. subtilis, Japan]
BKE10200 (Δ[gene|EDD5ACB89661D3B6D77057863EF345EBF84F49B2|yhfE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE10200 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGGGCATTCCTCCTTTT,  downstream forward: _UP4_CCAATGGTATAAGGGGGAGG
BKK10200 (Δ[gene|EDD5ACB89661D3B6D77057863EF345EBF84F49B2|yhfE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK10200 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGGGCATTCCTCCTTTT,  downstream forward: _UP4_CCAATGGTATAAGGGGGAGG

EDD5ACB89661D3B6D77057863EF345EBF84F49B2

Page visits: 3050

Time of last update: 2025-10-26 09:08:34

Author of last update: Melvin.boenninger