sipU

sipU
168

signal peptidase I

locus
BSU_04010
Molecular weight
21.04 kDa
pI
9.84
Protein length
Gene length
function
protein secretion
product
signal peptidase I
essential
no
synonyms
sipU, ycsB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0681 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
454,029  454,592
The protein
Catalyzed reaction/ biological activity
Cleavage of hydrophobic, N-terminal signal or leader sequences from secreted and periplasmic proteins (according to UniProt)
Protein family
[wiki|peptidase S26 family] (according to UniProt)
Structure
[PDB|4NV4] (from B. anthracis, 41% identity)
[AF|P42959]
Paralogous protein(s)
[protein|ADEEA5E15C100C1DC6E129B9A3E6DECAFCA8C409|sipV], [protein|C2EAE417DB9250B88BB0E25D4AE760BDE82EFD86|sipT], [protein|CDC6971F39F3EEAAE912CB1402EE1BD64D5A12A0|sipS]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|9824F9CF9C2028AF267AC43FE7FD8590E8231AB8|sipU]
description
[pubmed|22383849]
Open in new tab

[gene|9824F9CF9C2028AF267AC43FE7FD8590E8231AB8|sipU]

2025-10-18 16:52:25

Jstuelk

96

028b3bdaa67f29f2bc0f7bff294e1385944f46a4

8E1C2C585AF93143469E091BFD2FE03A2EDBC41A

Biological materials
Mutant
BKE04010 ([gene|9824F9CF9C2028AF267AC43FE7FD8590E8231AB8|sipU]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACTTCCTTCACCCGATGC,  downstream forward: _UP4_TAAAATGCAATGCAAAAAGA
BKK04010 ([gene|9824F9CF9C2028AF267AC43FE7FD8590E8231AB8|sipU]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACTTCCTTCACCCGATGC,  downstream forward: _UP4_TAAAATGCAATGCAAAAAGA
labs
[wiki|Jan Maarten van Dijl], Groningen, Netherlands
References
Reviews
22688815,34410368,40788091
Original Publications
9325333,9694797,28088521

9824F9CF9C2028AF267AC43FE7FD8590E8231AB8

Page visits: 4039

Time of last update: 2025-10-25 19:56:55

Author of last update: Jstuelk