ywlB

ywlB
168

general stress protein

locus
BSU_36960
Molecular weight
16.36 kDa
pI
5.23
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ywlB, ipc-28d

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1246 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,794,166 → 3,794,609
The protein
Structure
[AF|P39152]
Expression and Regulation
Operons
genes
[gene|B134C16B43A13C7B068BC24171C2B9B7AEADC19D|ywlB]
description
[Pubmed|9353933]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|B134C16B43A13C7B068BC24171C2B9B7AEADC19D|ywlB]

2025-10-23 13:51:53

ghost

65

be1c6caa9bc7aec6415a25ad6f38785c29dc193c

A004685B85F003A434A4C2E8416F60D351F47A03

Biological materials
Mutant
MGNA-A209 (ywlB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/209 NBRP B. subtilis, Japan]
BKE36960 (Δ[gene|B134C16B43A13C7B068BC24171C2B9B7AEADC19D|ywlB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE36960 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCGTTCACCCCGTTTTT,  downstream forward: _UP4_TAAGTGCAGTTTATACACAT
BKK36960 (Δ[gene|B134C16B43A13C7B068BC24171C2B9B7AEADC19D|ywlB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK36960 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCGTTCACCCCGTTTTT,  downstream forward: _UP4_TAAGTGCAGTTTATACACAT
References
15805528,9353933

B134C16B43A13C7B068BC24171C2B9B7AEADC19D

Page visits: 2232

Time of last update: 2025-10-24 14:20:22

Author of last update: Bzhu