yqbE
168
similar to phage-related protein
locus
BSU_26140
Molecular weight
34.36 kDa
pI
5.06
function
unknown
product
unknown
essential
no
ec
null
synonyms
yqbE
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms
This gene is a member of the following regulons
Gene
Coordinates
2,683,207 2,684,142
The protein
Structure
[AF|P45921]
Biological materials
Mutant
BKE26140 ([gene|1FA744589FB8B3479187054A4FC14039B973D6F3|yqbE]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE26140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGTATCCTCCTTATCC, downstream forward: _UP4_AAAGTGAAGGAGTAGGTGGT
BKK26140 ([gene|1FA744589FB8B3479187054A4FC14039B973D6F3|yqbE]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK26140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGTATCCTCCTTATCC, downstream forward: _UP4_AAAGTGAAGGAGTAGGTGGT
Page visits: 1740
Time of last update: 2025-10-27 13:53:39
Author of last update: Bzhu