yndJ
168
unknown
locus
BSU_17800
Molecular weight
62.30 kDa
pI
9.85
function
unknown
product
unknown
essential
no
synonyms
yndJ
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms
This gene is a member of the following regulons
Gene
Coordinates
1,912,953 → 1,914,593
The protein
Structure
[AF|O31813]
[wiki|Localization]
membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|963F684823CC1EEACBE5454F37E9B8829EA1EA23|yndG]-[gene|B949DBB16B0476F4073D77BE9F60D03E302FBBC1|yndH]-[gene|D5FE7BD56C10CD05B90DB3EDA0622D1982B38F68|yndJ]-[gene|12F3F8846739480E5980EE01A761990AE24B26F7|yndK]
description
[Pubmed|22383849]
Biological materials
Mutant
MGNA-B110 (yndJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1109 NBRP B. subtilis, Japan]
BKE17800 (Δ[gene|D5FE7BD56C10CD05B90DB3EDA0622D1982B38F68|yndJ]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE17800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCACTGACTATGCCATTTC, downstream forward: _UP4_TAACACAAAGAAGAAGCTTC
BKK17800 (Δ[gene|D5FE7BD56C10CD05B90DB3EDA0622D1982B38F68|yndJ]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK17800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCACTGACTATGCCATTTC, downstream forward: _UP4_TAACACAAAGAAGAAGCTTC
Page visits: 2104
Time of last update: 2025-10-23 03:44:57
Author of last update: Jstuelk