ydzT/2
168
putative integrase (fragment), internal part of YdzT
locus
BSU_06034
function
unknown
product
unknown
essential
-
ec
null
synonyms
ydzT/2
Outlinks
Genomic Context
Categories containing this gene/protein
This gene is a member of the following regulons
Gene
Coordinates
652,087 652,245
Biological materials
Mutant
BKE06034 ([gene|60C6A5E55F38F4EB2B118F3A3492A459A4C6CFD0|ydzT/2]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE06034 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCTATTTTTAAGCTTAA, downstream forward: _UP4_ATACCCATACCTCCTTACTA
BKK06034 ([gene|60C6A5E55F38F4EB2B118F3A3492A459A4C6CFD0|ydzT/2]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK06034 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCTATTTTTAAGCTTAA, downstream forward: _UP4_ATACCCATACCTCCTTACTA
Page visits: 1306
Time of last update: 2025-10-26 15:24:13
Author of last update: Bzhu