walH
168
negative effector of [protein|E88978809272FAC2520DB4ABCA0554F8028F3451|walK], controls cell wall metabolism
locus
BSU_40390
Molecular weight
52.05 kDa
pI
5.59
function
control of cell wall metabolism
product
negative effector of [protein|E88978809272FAC2520DB4ABCA0554F8028F3451|walK]
essential
no
synonyms
walH, yycH
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG4863 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
4,150,496 4,151,863
Phenotypes of a mutant
growth defect at high temperature, lysis at 49C, this can be suppressed by mutations that reduce [protein|E88978809272FAC2520DB4ABCA0554F8028F3451|walK] autokinase activity, by inactivation of [gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE], or by overexpreesion of [protein|0CA55371306D4BD768CFA82027DCB4D581BCCB87|iseA] or [protein|603E226CE488A25C4E28A6A7363CCD65BE64BB21|pdaC] [pubmed|29465029]
defective in [category|SW.4.1.4|Swarming] motility (periodic cessation and reinitiation of [category|SW.4.1.4|Swarming] motility, terracing colonies) [pubmed|35638827]
additional information
the gene readily acquires mutations during cultivation with Arabidopsis thaliana roots [pubmed|37768063]
The protein
Structure
[PDB|2FGT]
[AF|Q794W0]
[wiki|Localization]
cell membrane (according to UniProt), spotty close to the membrane [Pubmed|21219466]
Expression and Regulation
Operons
genes
[gene|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|walR]-[gene|E88978809272FAC2520DB4ABCA0554F8028F3451|walK]-[gene|06D2D03C65D50E3909B2C93835193815B6016967|walH]-[gene|EE681C9A42FCC29CBB55CC9566EE4CFF986D0F1D|walI]-[gene|D5321F707E183E72B225F1CED2F2FDCB1183B88A|walJ]-[gene|75B8C37E589C855D2BAD7FB51B9600E161ACFBD3|htrC]
description
[Pubmed|9829949]
regulation
''htrC'' transcript expressed during sporulation [Pubmed|9829949]
Biological materials
Mutant
MGNA-B826 (yycH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1825 NBRP B. subtilis, Japan]
BKE40390 ([gene|06D2D03C65D50E3909B2C93835193815B6016967|walH]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE40390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTAAGTAATATCGTTTTTA, downstream forward: _UP4_TTATTGAGGAAGGAGGGGGC
BKK40390 ([gene|06D2D03C65D50E3909B2C93835193815B6016967|walH]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK40390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTAAGTAATATCGTTTTTA, downstream forward: _UP4_TTATTGAGGAAGGAGGGGGC
References
Reviews
Original Publications
Page visits: 4227
Time of last update: 2025-10-28 20:35:50
Author of last update: Jstuelk