ywrD

168

unknown, similar to gamma-glutamyltransferase ([protein|5C31D968E3786858B025CE02CFAC48F61700031F|ggt])

locus: BSU_36100

Molecular weight: 57.32 kDa

pI: 5.45

Protein length: 525 aa

Gene length: 1578 bp

function: unknown

product: unknown

essential: no

ec: 2.3.2.2

synonyms: ywrD

List of homologs in different organisms, belongs to COG0405 (Galperin et al., 2021)

Gene

Coordinates: 3,719,134 → 3,720,711

Advertisement

The protein

Catalyzed reaction/ biological activity

• an α-amino acid + an N-terminal (5-L-glutamyl)-[peptide] --> 5-L-glutamyl amino acid + N-terminal L-α-aminoacyl-[peptide] (according to UniProt)
• glutathione + H₂O --> L-cysteinylglycine + L-glutamate (according to UniProt)
• an S-substituted glutathione + H₂O --> an S-substitued L-cysteinylglycine + L-glutamate, however, all evidence suggests this is a misannotation [Pubmed|19935659]

Protein family

• gamma-glutamyltransferase family (with [protein|5C31D968E3786858B025CE02CFAC48F61700031F|ggt], according to UniProt), however, all evidence suggests this is a misannotation [Pubmed|19935659]

Structure

• [PDB|2NLZ] (from B. halodurans, 38% identity)
• [AF|O05218]

Additional information

• The gene is annotated in KEGG as an ortholog of gamma-glutamyltranspeptidase EC 2.3.2.2, This enzyme is necessary to utilize glutathione (GSH) as the sulfur source. No EC annotation for this gene is available in Swiss-Prot/MetaCyc. It has been shown by Minami et al. ([Pubmed|14762019]) that ywrD mutant grows well on minimal media supplied with GSH as the sole sulfur source. In addition, His-tag purified ywrD cannot hydrolyze GSH. [Pubmed|19935659]

Biological materials

Mutant

• MGNA-B653 (ywrD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1652 NBRP B. subtilis, Japan]
• BKE36100 (Δ[gene|F1DF59528E340A65A982BD7E6621DDA82C10B2B5|ywrD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE36100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCACAAGTCCCCTTTTTT,  downstream forward: _UP4_GGAGCGGCTGTGGGGATTTA
• BKK36100 (Δ[gene|F1DF59528E340A65A982BD7E6621DDA82C10B2B5|ywrD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK36100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCACAAGTCCCCTTTTTT,  downstream forward: _UP4_GGAGCGGCTGTGGGGATTTA

References

• 12823818,25755103,14762019