ywjC
168
general stress protein
locus
BSU_37210
Molecular weight
10.33 kDa
pI
9.32
function
unknown
product
unknown
essential
no
ec
null
synonyms
ywjC
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms
This gene is a member of the following regulons
Gene
Coordinates
3,818,906 3,819,178
The protein
Structure
[AF|P45863]
Expression and Regulation
Operons
genes
[gene|3AE330E2FBAB1C24FD2105472390C574DB3012CD|ywjC]
description
[Pubmed|9353933]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|11544224,11532142]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|11544224,11532142], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Biological materials
Mutant
BKE37210 ([gene|3AE330E2FBAB1C24FD2105472390C574DB3012CD|ywjC]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE37210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCTTTCTCCTCCATC, downstream forward: _UP4_TAACTTACATACAAAAAAGG
BKK37210 ([gene|3AE330E2FBAB1C24FD2105472390C574DB3012CD|ywjC]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK37210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCTTTCTCCTCCATC, downstream forward: _UP4_TAACTTACATACAAAAAAGG
References
Page visits: 2272
Time of last update: 2025-10-26 07:53:40
Author of last update: Bzhu