yusY/1
168
similar to oligoendopeptidase, inactive pseudogene
locus
BSU_32960
Molecular weight
57.00 kDa
pI
5.695
function
unknown
product
unknown
essential
no
synonyms
yusY/1
Outlinks
Genomic Context
Categories containing this gene/protein
This gene is a member of the following regulons
Gene
Coordinates
3,380,704 3,382,212
The protein
Structure
[PDB|3CE2] (from Chlamydophila abortus, 23% identity)
Paralogous protein(s)
[protein|3F0700B5E3B944116D2F9A150F7AB4263A3E41EE|pepF]
Expression and Regulation
Operons
genes
[gene|91C89960ABE800BB25CA48A97A5D32CC308D3D31|yusY/1]-[gene|C56194753AF3CA8068B1FE15445EA32FAA2B8A62|yusY]
description
[Pubmed|22383849]
Biological materials
Mutant
BKE32960 ([gene|91C89960ABE800BB25CA48A97A5D32CC308D3D31|yusY/1]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE32960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAGGCCTGATGCTCTATAGC, downstream forward: _UP4_TAAAGAAAAAGCCGTGGCGT
BKK32960 ([gene|91C89960ABE800BB25CA48A97A5D32CC308D3D31|yusY/1]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK32960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAGGCCTGATGCTCTATAGC, downstream forward: _UP4_TAAAGAAAAAGCCGTGGCGT
References
Page visits: 1608
Time of last update: 2025-10-27 13:56:00
Author of last update: Jstuelk