iolU

iolU
168

minor NADP-dependent scyllo-inositol dehydrogenase

locus
BSU_31170
Molecular weight
36.36 kDa
pI
5.15
Protein length
Gene length
function
utilization of scyllo-inosose
product
minor NADP-dependent scyllo-inositol dehydrogenase
essential
no
synonyms
iolU, yulF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0673 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,196,906  3,197,892
The protein
Catalyzed reaction/ biological activity
NADPH-dependent conversion of scyllo-inosose to scyllo-inositol [pubmed|28043209]
NADP+ + scyllo-inositol --> H+ + NADPH + scyllo-inosose (according to UniProt)
Protein family
[wiki|Gfo/Idh/MocA family] (according to UniProt)
[wiki|Cofactors]
NADP+ [pubmed|28043209]
Structure
[PDB|4NHE] (oxidoreductase from ''Streptococcus pneumoniae'')
[AF|O05265]
Paralogous protein(s)
[protein|93C1DF93CAFC5AE726523A91A3BA7470017FF6DC|iolG], [protein|942BAE9FA023DFCA06B6D26A856A72F2979E23FA|yrbE], [protein|AA7DCEFB17FD6F9C4F65235E9A247A6EC2242B06|iolX], [protein|03BE6DA854612B3F6741E0E167AB310F0DE96285|yfiI], [protein|29DAF5343A42EAD8DB97925FE7D049410F7B7FCA|ntdC], [protein|484D17480DFAD3667E0EBC6D38854A7546A8DB46|yteT], [protein|7DFE74C751A67CCC84579D52005E1399B0A10166|iolW]
Expression and Regulation
Operons
genes
[gene|920C5750CB95102B073C32874D512E8D636D2C7D|iolU]
description
[Pubmed|9274030]
Open in new tab

[gene|920C5750CB95102B073C32874D512E8D636D2C7D|iolU]

2025-10-23 18:00:04

ghost

87

48e31013e46b4b34dd8f1906ffc2883897961607

DEBF2C42B05AC261A3FE97A7D99CE62441D01F9D

Biological materials
Mutant
MGNA-A228 (yulF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/228 NBRP B. subtilis, Japan]
BKE31170 ([gene|920C5750CB95102B073C32874D512E8D636D2C7D|iolU]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE31170 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTCGTATCGCTCCTTTTG,  downstream forward: _UP4_TAAAAAAATCCGCCCGCGTG
BKK31170 ([gene|920C5750CB95102B073C32874D512E8D636D2C7D|iolU]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK31170 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTCGTATCGCTCCTTTTG,  downstream forward: _UP4_TAAAAAAATCCGCCCGCGTG
References
9274030,28043209

920C5750CB95102B073C32874D512E8D636D2C7D

Page visits: 3445

Time of last update: 2025-10-27 02:52:58

Author of last update: Melvin.boenninger